ID: 1202828698

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000009v2_random:3610-3632
Sequence GTGTACACCCCCTGCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202828688_1202828698 24 Left 1202828688 14_GL000009v2_random:3563-3585 CCAATATCCTTTTCCCCCATGGA No data
Right 1202828698 14_GL000009v2_random:3610-3632 GTGTACACCCCCTGCCATATTGG No data
1202828686_1202828698 25 Left 1202828686 14_GL000009v2_random:3562-3584 CCCAATATCCTTTTCCCCCATGG No data
Right 1202828698 14_GL000009v2_random:3610-3632 GTGTACACCCCCTGCCATATTGG No data
1202828693_1202828698 9 Left 1202828693 14_GL000009v2_random:3578-3600 CCCATGGATATAGGAACAGTATC No data
Right 1202828698 14_GL000009v2_random:3610-3632 GTGTACACCCCCTGCCATATTGG No data
1202828691_1202828698 11 Left 1202828691 14_GL000009v2_random:3576-3598 CCCCCATGGATATAGGAACAGTA No data
Right 1202828698 14_GL000009v2_random:3610-3632 GTGTACACCCCCTGCCATATTGG No data
1202828690_1202828698 17 Left 1202828690 14_GL000009v2_random:3570-3592 CCTTTTCCCCCATGGATATAGGA No data
Right 1202828698 14_GL000009v2_random:3610-3632 GTGTACACCCCCTGCCATATTGG No data
1202828694_1202828698 8 Left 1202828694 14_GL000009v2_random:3579-3601 CCATGGATATAGGAACAGTATCC No data
Right 1202828698 14_GL000009v2_random:3610-3632 GTGTACACCCCCTGCCATATTGG No data
1202828692_1202828698 10 Left 1202828692 14_GL000009v2_random:3577-3599 CCCCATGGATATAGGAACAGTAT No data
Right 1202828698 14_GL000009v2_random:3610-3632 GTGTACACCCCCTGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202828698 Original CRISPR GTGTACACCCCCTGCCATAT TGG Intergenic
No off target data available for this crispr