ID: 1202836134

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000009v2_random:78679-78701
Sequence TGTACAGGACCTCCCAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202836127_1202836134 -2 Left 1202836127 14_GL000009v2_random:78658-78680 CCCGACCCTGTTGCACATCACTG No data
Right 1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG No data
1202836130_1202836134 -8 Left 1202836130 14_GL000009v2_random:78664-78686 CCTGTTGCACATCACTGTACAGG No data
Right 1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG No data
1202836128_1202836134 -3 Left 1202836128 14_GL000009v2_random:78659-78681 CCGACCCTGTTGCACATCACTGT No data
Right 1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG No data
1202836129_1202836134 -7 Left 1202836129 14_GL000009v2_random:78663-78685 CCCTGTTGCACATCACTGTACAG No data
Right 1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG No data
1202836126_1202836134 -1 Left 1202836126 14_GL000009v2_random:78657-78679 CCCCGACCCTGTTGCACATCACT No data
Right 1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG No data
1202836124_1202836134 22 Left 1202836124 14_GL000009v2_random:78634-78656 CCAGAATGCTTCTGTAAGCAGGC 0: 11
1: 14
2: 7
3: 121
4: 331
Right 1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG No data
1202836125_1202836134 0 Left 1202836125 14_GL000009v2_random:78656-78678 CCCCCGACCCTGTTGCACATCAC No data
Right 1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202836134 Original CRISPR TGTACAGGACCTCCCAAATG GGG Intergenic
No off target data available for this crispr