ID: 1202848383

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:843-865
Sequence GGAGCTCCATGGTGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202848374_1202848383 22 Left 1202848374 14_GL000225v1_random:798-820 CCACGAGTCCAGCAAAGAGAGCT No data
Right 1202848383 14_GL000225v1_random:843-865 GGAGCTCCATGGTGGCAGCTGGG No data
1202848376_1202848383 14 Left 1202848376 14_GL000225v1_random:806-828 CCAGCAAAGAGAGCTAGAGGTCT No data
Right 1202848383 14_GL000225v1_random:843-865 GGAGCTCCATGGTGGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202848383 Original CRISPR GGAGCTCCATGGTGGCAGCT GGG Intergenic
No off target data available for this crispr