ID: 1202848778

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:2379-2401
Sequence GGCACTCCATGGTGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202848778_1202848786 22 Left 1202848778 14_GL000225v1_random:2379-2401 CCCAGCTGCCACCATGGAGTGCC No data
Right 1202848786 14_GL000225v1_random:2424-2446 AGCTCTCTTAGCTTGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202848778 Original CRISPR GGCACTCCATGGTGGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr