ID: 1202849363

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:7480-7502
Sequence CAGGTGATGGGACTTTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202849363_1202849369 16 Left 1202849363 14_GL000225v1_random:7480-7502 CCAGAGAAAAGTCCCATCACCTG No data
Right 1202849369 14_GL000225v1_random:7519-7541 ATATGTCACAAAGCCCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202849363 Original CRISPR CAGGTGATGGGACTTTTCTC TGG (reversed) Intergenic
No off target data available for this crispr