ID: 1202849369

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:7519-7541
Sequence ATATGTCACAAAGCCCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202849366_1202849369 4 Left 1202849366 14_GL000225v1_random:7492-7514 CCCATCACCTGGGTGATTAGTGC No data
Right 1202849369 14_GL000225v1_random:7519-7541 ATATGTCACAAAGCCCCTGTAGG No data
1202849361_1202849369 29 Left 1202849361 14_GL000225v1_random:7467-7489 CCATAGGCAGAGCCCAGAGAAAA No data
Right 1202849369 14_GL000225v1_random:7519-7541 ATATGTCACAAAGCCCCTGTAGG No data
1202849367_1202849369 3 Left 1202849367 14_GL000225v1_random:7493-7515 CCATCACCTGGGTGATTAGTGCA No data
Right 1202849369 14_GL000225v1_random:7519-7541 ATATGTCACAAAGCCCCTGTAGG No data
1202849368_1202849369 -3 Left 1202849368 14_GL000225v1_random:7499-7521 CCTGGGTGATTAGTGCAGAGATA No data
Right 1202849369 14_GL000225v1_random:7519-7541 ATATGTCACAAAGCCCCTGTAGG No data
1202849360_1202849369 30 Left 1202849360 14_GL000225v1_random:7466-7488 CCCATAGGCAGAGCCCAGAGAAA No data
Right 1202849369 14_GL000225v1_random:7519-7541 ATATGTCACAAAGCCCCTGTAGG No data
1202849362_1202849369 17 Left 1202849362 14_GL000225v1_random:7479-7501 CCCAGAGAAAAGTCCCATCACCT No data
Right 1202849369 14_GL000225v1_random:7519-7541 ATATGTCACAAAGCCCCTGTAGG No data
1202849363_1202849369 16 Left 1202849363 14_GL000225v1_random:7480-7502 CCAGAGAAAAGTCCCATCACCTG No data
Right 1202849369 14_GL000225v1_random:7519-7541 ATATGTCACAAAGCCCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202849369 Original CRISPR ATATGTCACAAAGCCCCTGT AGG Intergenic
No off target data available for this crispr