ID: 1202849684

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:8991-9013
Sequence GGCTCACGAAATCCCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202849684_1202849693 16 Left 1202849684 14_GL000225v1_random:8991-9013 CCCACTGGGGGATTTCGTGAGCC No data
Right 1202849693 14_GL000225v1_random:9030-9052 CCCCGTGCTCCAGCCCAGCCAGG 0: 9
1: 10
2: 35
3: 72
4: 786
1202849684_1202849698 29 Left 1202849684 14_GL000225v1_random:8991-9013 CCCACTGGGGGATTTCGTGAGCC No data
Right 1202849698 14_GL000225v1_random:9043-9065 CCCAGCCAGGCCGTGCCTGCAGG No data
1202849684_1202849700 30 Left 1202849684 14_GL000225v1_random:8991-9013 CCCACTGGGGGATTTCGTGAGCC No data
Right 1202849700 14_GL000225v1_random:9044-9066 CCAGCCAGGCCGTGCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202849684 Original CRISPR GGCTCACGAAATCCCCCAGT GGG (reversed) Intergenic
No off target data available for this crispr