ID: 1202850579

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:15341-15363
Sequence CTTGTCTAAGCTCTGTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202850579_1202850583 30 Left 1202850579 14_GL000225v1_random:15341-15363 CCTGTAGACAGAGCTTAGACAAG No data
Right 1202850583 14_GL000225v1_random:15394-15416 TAAGTTGTAAAGCCTCCTGTAGG No data
1202850579_1202850581 6 Left 1202850579 14_GL000225v1_random:15341-15363 CCTGTAGACAGAGCTTAGACAAG No data
Right 1202850581 14_GL000225v1_random:15370-15392 ATCACCTAGTGATCAGTGCAGGG No data
1202850579_1202850580 5 Left 1202850579 14_GL000225v1_random:15341-15363 CCTGTAGACAGAGCTTAGACAAG No data
Right 1202850580 14_GL000225v1_random:15369-15391 CATCACCTAGTGATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202850579 Original CRISPR CTTGTCTAAGCTCTGTCTAC AGG (reversed) Intergenic
No off target data available for this crispr