ID: 1202850595

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:15503-15525
Sequence TACATCACATGTTTGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202850590_1202850595 4 Left 1202850590 14_GL000225v1_random:15476-15498 CCCTGTAAGTAGAACCTTGACAA No data
Right 1202850595 14_GL000225v1_random:15503-15525 TACATCACATGTTTGATCAGTGG No data
1202850589_1202850595 5 Left 1202850589 14_GL000225v1_random:15475-15497 CCCCTGTAAGTAGAACCTTGACA No data
Right 1202850595 14_GL000225v1_random:15503-15525 TACATCACATGTTTGATCAGTGG No data
1202850591_1202850595 3 Left 1202850591 14_GL000225v1_random:15477-15499 CCTGTAAGTAGAACCTTGACAAG No data
Right 1202850595 14_GL000225v1_random:15503-15525 TACATCACATGTTTGATCAGTGG No data
1202850594_1202850595 -10 Left 1202850594 14_GL000225v1_random:15490-15512 CCTTGACAAGGGTTACATCACAT No data
Right 1202850595 14_GL000225v1_random:15503-15525 TACATCACATGTTTGATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202850595 Original CRISPR TACATCACATGTTTGATCAG TGG Intergenic
No off target data available for this crispr