ID: 1202852574

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:30673-30695
Sequence GGATCATGAAAGCCACCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202852574_1202852583 16 Left 1202852574 14_GL000225v1_random:30673-30695 CCCAAAGGTGGCTTTCATGATCC No data
Right 1202852583 14_GL000225v1_random:30712-30734 CCCCCTGCTCCAGCCCAGCCAGG No data
1202852574_1202852588 25 Left 1202852574 14_GL000225v1_random:30673-30695 CCCAAAGGTGGCTTTCATGATCC No data
Right 1202852588 14_GL000225v1_random:30721-30743 CCAGCCCAGCCAGGCCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202852574 Original CRISPR GGATCATGAAAGCCACCTTT GGG (reversed) Intergenic
No off target data available for this crispr