ID: 1202853644

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:36965-36987
Sequence GGCTCAAGAAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202853644_1202853653 16 Left 1202853644 14_GL000225v1_random:36965-36987 CCCACAGGGGGCTTTCTTGAGCC No data
Right 1202853653 14_GL000225v1_random:37004-37026 CCACGTGCTCCAGCCCAGCCTGG No data
1202853644_1202853655 25 Left 1202853644 14_GL000225v1_random:36965-36987 CCCACAGGGGGCTTTCTTGAGCC No data
Right 1202853655 14_GL000225v1_random:37013-37035 CCAGCCCAGCCTGGCCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202853644 Original CRISPR GGCTCAAGAAAGCCCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr