ID: 1202854054

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:38841-38863
Sequence GATCTCTCCACTGCTCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854054_1202854061 27 Left 1202854054 14_GL000225v1_random:38841-38863 CCTGGGTGAGCAGTGGAGAGATC No data
Right 1202854061 14_GL000225v1_random:38891-38913 TAGATAAGGGTTACATCACCTGG No data
1202854054_1202854060 14 Left 1202854054 14_GL000225v1_random:38841-38863 CCTGGGTGAGCAGTGGAGAGATC No data
Right 1202854060 14_GL000225v1_random:38878-38900 TGTAGGCAGAGCTTAGATAAGGG No data
1202854054_1202854062 28 Left 1202854054 14_GL000225v1_random:38841-38863 CCTGGGTGAGCAGTGGAGAGATC No data
Right 1202854062 14_GL000225v1_random:38892-38914 AGATAAGGGTTACATCACCTGGG No data
1202854054_1202854059 13 Left 1202854054 14_GL000225v1_random:38841-38863 CCTGGGTGAGCAGTGGAGAGATC No data
Right 1202854059 14_GL000225v1_random:38877-38899 CTGTAGGCAGAGCTTAGATAAGG No data
1202854054_1202854055 -3 Left 1202854054 14_GL000225v1_random:38841-38863 CCTGGGTGAGCAGTGGAGAGATC No data
Right 1202854055 14_GL000225v1_random:38861-38883 ATCTGTCACAATGCCCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854054 Original CRISPR GATCTCTCCACTGCTCACCC AGG (reversed) Intergenic