ID: 1202854057

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:38875-38897
Sequence TTATCTAAGCTCTGCCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854057_1202854061 -7 Left 1202854057 14_GL000225v1_random:38875-38897 CCCTGTAGGCAGAGCTTAGATAA No data
Right 1202854061 14_GL000225v1_random:38891-38913 TAGATAAGGGTTACATCACCTGG No data
1202854057_1202854065 30 Left 1202854057 14_GL000225v1_random:38875-38897 CCCTGTAGGCAGAGCTTAGATAA No data
Right 1202854065 14_GL000225v1_random:38928-38950 GATATGTCAAAAGGCTCCCCTGG No data
1202854057_1202854062 -6 Left 1202854057 14_GL000225v1_random:38875-38897 CCCTGTAGGCAGAGCTTAGATAA No data
Right 1202854062 14_GL000225v1_random:38892-38914 AGATAAGGGTTACATCACCTGGG No data
1202854057_1202854064 21 Left 1202854057 14_GL000225v1_random:38875-38897 CCCTGTAGGCAGAGCTTAGATAA No data
Right 1202854064 14_GL000225v1_random:38919-38941 CAGTGCAGAGATATGTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854057 Original CRISPR TTATCTAAGCTCTGCCTACA GGG (reversed) Intergenic
No off target data available for this crispr