ID: 1202854062

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:38892-38914
Sequence AGATAAGGGTTACATCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854056_1202854062 -5 Left 1202854056 14_GL000225v1_random:38874-38896 CCCCTGTAGGCAGAGCTTAGATA No data
Right 1202854062 14_GL000225v1_random:38892-38914 AGATAAGGGTTACATCACCTGGG No data
1202854054_1202854062 28 Left 1202854054 14_GL000225v1_random:38841-38863 CCTGGGTGAGCAGTGGAGAGATC No data
Right 1202854062 14_GL000225v1_random:38892-38914 AGATAAGGGTTACATCACCTGGG No data
1202854058_1202854062 -7 Left 1202854058 14_GL000225v1_random:38876-38898 CCTGTAGGCAGAGCTTAGATAAG No data
Right 1202854062 14_GL000225v1_random:38892-38914 AGATAAGGGTTACATCACCTGGG No data
1202854057_1202854062 -6 Left 1202854057 14_GL000225v1_random:38875-38897 CCCTGTAGGCAGAGCTTAGATAA No data
Right 1202854062 14_GL000225v1_random:38892-38914 AGATAAGGGTTACATCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854062 Original CRISPR AGATAAGGGTTACATCACCT GGG Intergenic
No off target data available for this crispr