ID: 1202854064 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14_GL000225v1_random:38919-38941 |
| Sequence | CAGTGCAGAGATATGTCAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202854056_1202854064 | 22 | Left | 1202854056 | 14_GL000225v1_random:38874-38896 | CCCCTGTAGGCAGAGCTTAGATA | No data | ||
| Right | 1202854064 | 14_GL000225v1_random:38919-38941 | CAGTGCAGAGATATGTCAAAAGG | No data | ||||
| 1202854058_1202854064 | 20 | Left | 1202854058 | 14_GL000225v1_random:38876-38898 | CCTGTAGGCAGAGCTTAGATAAG | No data | ||
| Right | 1202854064 | 14_GL000225v1_random:38919-38941 | CAGTGCAGAGATATGTCAAAAGG | No data | ||||
| 1202854057_1202854064 | 21 | Left | 1202854057 | 14_GL000225v1_random:38875-38897 | CCCTGTAGGCAGAGCTTAGATAA | No data | ||
| Right | 1202854064 | 14_GL000225v1_random:38919-38941 | CAGTGCAGAGATATGTCAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202854064 | Original CRISPR | CAGTGCAGAGATATGTCAAA AGG | Intergenic | ||