ID: 1202854064

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:38919-38941
Sequence CAGTGCAGAGATATGTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854056_1202854064 22 Left 1202854056 14_GL000225v1_random:38874-38896 CCCCTGTAGGCAGAGCTTAGATA No data
Right 1202854064 14_GL000225v1_random:38919-38941 CAGTGCAGAGATATGTCAAAAGG No data
1202854058_1202854064 20 Left 1202854058 14_GL000225v1_random:38876-38898 CCTGTAGGCAGAGCTTAGATAAG No data
Right 1202854064 14_GL000225v1_random:38919-38941 CAGTGCAGAGATATGTCAAAAGG No data
1202854057_1202854064 21 Left 1202854057 14_GL000225v1_random:38875-38897 CCCTGTAGGCAGAGCTTAGATAA No data
Right 1202854064 14_GL000225v1_random:38919-38941 CAGTGCAGAGATATGTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854064 Original CRISPR CAGTGCAGAGATATGTCAAA AGG Intergenic
No off target data available for this crispr