ID: 1202854065

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:38928-38950
Sequence GATATGTCAAAAGGCTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854057_1202854065 30 Left 1202854057 14_GL000225v1_random:38875-38897 CCCTGTAGGCAGAGCTTAGATAA No data
Right 1202854065 14_GL000225v1_random:38928-38950 GATATGTCAAAAGGCTCCCCTGG No data
1202854063_1202854065 -4 Left 1202854063 14_GL000225v1_random:38909-38931 CCTGGGTGATCAGTGCAGAGATA 0: 345
1: 634
2: 616
3: 450
4: 408
Right 1202854065 14_GL000225v1_random:38928-38950 GATATGTCAAAAGGCTCCCCTGG No data
1202854058_1202854065 29 Left 1202854058 14_GL000225v1_random:38876-38898 CCTGTAGGCAGAGCTTAGATAAG No data
Right 1202854065 14_GL000225v1_random:38928-38950 GATATGTCAAAAGGCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854065 Original CRISPR GATATGTCAAAAGGCTCCCC TGG Intergenic
No off target data available for this crispr