ID: 1202854065 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14_GL000225v1_random:38928-38950 |
Sequence | GATATGTCAAAAGGCTCCCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202854058_1202854065 | 29 | Left | 1202854058 | 14_GL000225v1_random:38876-38898 | CCTGTAGGCAGAGCTTAGATAAG | No data | ||
Right | 1202854065 | 14_GL000225v1_random:38928-38950 | GATATGTCAAAAGGCTCCCCTGG | No data | ||||
1202854063_1202854065 | -4 | Left | 1202854063 | 14_GL000225v1_random:38909-38931 | CCTGGGTGATCAGTGCAGAGATA | No data | ||
Right | 1202854065 | 14_GL000225v1_random:38928-38950 | GATATGTCAAAAGGCTCCCCTGG | No data | ||||
1202854057_1202854065 | 30 | Left | 1202854057 | 14_GL000225v1_random:38875-38897 | CCCTGTAGGCAGAGCTTAGATAA | No data | ||
Right | 1202854065 | 14_GL000225v1_random:38928-38950 | GATATGTCAAAAGGCTCCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202854065 | Original CRISPR | GATATGTCAAAAGGCTCCCC TGG | Intergenic | ||