ID: 1202854066

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:38929-38951
Sequence ATATGTCAAAAGGCTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854063_1202854066 -3 Left 1202854063 14_GL000225v1_random:38909-38931 CCTGGGTGATCAGTGCAGAGATA 0: 345
1: 634
2: 616
3: 450
4: 408
Right 1202854066 14_GL000225v1_random:38929-38951 ATATGTCAAAAGGCTCCCCTGGG No data
1202854058_1202854066 30 Left 1202854058 14_GL000225v1_random:38876-38898 CCTGTAGGCAGAGCTTAGATAAG No data
Right 1202854066 14_GL000225v1_random:38929-38951 ATATGTCAAAAGGCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854066 Original CRISPR ATATGTCAAAAGGCTCCCCT GGG Intergenic
No off target data available for this crispr