ID: 1202854752

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:43396-43418
Sequence GCCCCCTGTGGGAGAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854752_1202854761 27 Left 1202854752 14_GL000225v1_random:43396-43418 CCTGTGGCTCTCCCACAGGGGGC No data
Right 1202854761 14_GL000225v1_random:43446-43468 CCCCGTGCTCCAGCGCAGCCAGG No data
1202854752_1202854756 -8 Left 1202854752 14_GL000225v1_random:43396-43418 CCTGTGGCTCTCCCACAGGGGGC No data
Right 1202854756 14_GL000225v1_random:43411-43433 CAGGGGGCTTTCGTGAGGCAAGG No data
1202854752_1202854757 -1 Left 1202854752 14_GL000225v1_random:43396-43418 CCTGTGGCTCTCCCACAGGGGGC No data
Right 1202854757 14_GL000225v1_random:43418-43440 CTTTCGTGAGGCAAGGAGCGAGG No data
1202854752_1202854758 0 Left 1202854752 14_GL000225v1_random:43396-43418 CCTGTGGCTCTCCCACAGGGGGC No data
Right 1202854758 14_GL000225v1_random:43419-43441 TTTCGTGAGGCAAGGAGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854752 Original CRISPR GCCCCCTGTGGGAGAGCCAC AGG (reversed) Intergenic