ID: 1202854754

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:43407-43429
Sequence GCCTCACGAAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854754_1202854767 25 Left 1202854754 14_GL000225v1_random:43407-43429 CCCACAGGGGGCTTTCGTGAGGC No data
Right 1202854767 14_GL000225v1_random:43455-43477 CCAGCGCAGCCAGGCCGGGCTGG No data
1202854754_1202854765 21 Left 1202854754 14_GL000225v1_random:43407-43429 CCCACAGGGGGCTTTCGTGAGGC No data
Right 1202854765 14_GL000225v1_random:43451-43473 TGCTCCAGCGCAGCCAGGCCGGG No data
1202854754_1202854761 16 Left 1202854754 14_GL000225v1_random:43407-43429 CCCACAGGGGGCTTTCGTGAGGC No data
Right 1202854761 14_GL000225v1_random:43446-43468 CCCCGTGCTCCAGCGCAGCCAGG No data
1202854754_1202854764 20 Left 1202854754 14_GL000225v1_random:43407-43429 CCCACAGGGGGCTTTCGTGAGGC No data
Right 1202854764 14_GL000225v1_random:43450-43472 GTGCTCCAGCGCAGCCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854754 Original CRISPR GCCTCACGAAAGCCCCCTGT GGG (reversed) Intergenic