ID: 1202854755

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:43408-43430
Sequence TGCCTCACGAAAGCCCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854755_1202854767 24 Left 1202854755 14_GL000225v1_random:43408-43430 CCACAGGGGGCTTTCGTGAGGCA No data
Right 1202854767 14_GL000225v1_random:43455-43477 CCAGCGCAGCCAGGCCGGGCTGG No data
1202854755_1202854765 20 Left 1202854755 14_GL000225v1_random:43408-43430 CCACAGGGGGCTTTCGTGAGGCA No data
Right 1202854765 14_GL000225v1_random:43451-43473 TGCTCCAGCGCAGCCAGGCCGGG No data
1202854755_1202854761 15 Left 1202854755 14_GL000225v1_random:43408-43430 CCACAGGGGGCTTTCGTGAGGCA No data
Right 1202854761 14_GL000225v1_random:43446-43468 CCCCGTGCTCCAGCGCAGCCAGG No data
1202854755_1202854764 19 Left 1202854755 14_GL000225v1_random:43408-43430 CCACAGGGGGCTTTCGTGAGGCA No data
Right 1202854764 14_GL000225v1_random:43450-43472 GTGCTCCAGCGCAGCCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854755 Original CRISPR TGCCTCACGAAAGCCCCCTG TGG (reversed) Intergenic
No off target data available for this crispr