ID: 1202854757

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:43418-43440
Sequence CTTTCGTGAGGCAAGGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854740_1202854757 23 Left 1202854740 14_GL000225v1_random:43372-43394 CCCGCACCCCACGTTCCCTGCGC No data
Right 1202854757 14_GL000225v1_random:43418-43440 CTTTCGTGAGGCAAGGAGCGAGG No data
1202854752_1202854757 -1 Left 1202854752 14_GL000225v1_random:43396-43418 CCTGTGGCTCTCCCACAGGGGGC No data
Right 1202854757 14_GL000225v1_random:43418-43440 CTTTCGTGAGGCAAGGAGCGAGG No data
1202854746_1202854757 8 Left 1202854746 14_GL000225v1_random:43387-43409 CCCTGCGCGCCTGTGGCTCTCCC No data
Right 1202854757 14_GL000225v1_random:43418-43440 CTTTCGTGAGGCAAGGAGCGAGG No data
1202854743_1202854757 16 Left 1202854743 14_GL000225v1_random:43379-43401 CCCACGTTCCCTGCGCGCCTGTG No data
Right 1202854757 14_GL000225v1_random:43418-43440 CTTTCGTGAGGCAAGGAGCGAGG No data
1202854744_1202854757 15 Left 1202854744 14_GL000225v1_random:43380-43402 CCACGTTCCCTGCGCGCCTGTGG No data
Right 1202854757 14_GL000225v1_random:43418-43440 CTTTCGTGAGGCAAGGAGCGAGG No data
1202854742_1202854757 17 Left 1202854742 14_GL000225v1_random:43378-43400 CCCCACGTTCCCTGCGCGCCTGT No data
Right 1202854757 14_GL000225v1_random:43418-43440 CTTTCGTGAGGCAAGGAGCGAGG No data
1202854741_1202854757 22 Left 1202854741 14_GL000225v1_random:43373-43395 CCGCACCCCACGTTCCCTGCGCG No data
Right 1202854757 14_GL000225v1_random:43418-43440 CTTTCGTGAGGCAAGGAGCGAGG No data
1202854747_1202854757 7 Left 1202854747 14_GL000225v1_random:43388-43410 CCTGCGCGCCTGTGGCTCTCCCA No data
Right 1202854757 14_GL000225v1_random:43418-43440 CTTTCGTGAGGCAAGGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854757 Original CRISPR CTTTCGTGAGGCAAGGAGCG AGG Intergenic