ID: 1202854761

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:43446-43468
Sequence CCCCGTGCTCCAGCGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854752_1202854761 27 Left 1202854752 14_GL000225v1_random:43396-43418 CCTGTGGCTCTCCCACAGGGGGC No data
Right 1202854761 14_GL000225v1_random:43446-43468 CCCCGTGCTCCAGCGCAGCCAGG No data
1202854755_1202854761 15 Left 1202854755 14_GL000225v1_random:43408-43430 CCACAGGGGGCTTTCGTGAGGCA No data
Right 1202854761 14_GL000225v1_random:43446-43468 CCCCGTGCTCCAGCGCAGCCAGG No data
1202854754_1202854761 16 Left 1202854754 14_GL000225v1_random:43407-43429 CCCACAGGGGGCTTTCGTGAGGC No data
Right 1202854761 14_GL000225v1_random:43446-43468 CCCCGTGCTCCAGCGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854761 Original CRISPR CCCCGTGCTCCAGCGCAGCC AGG Intergenic
No off target data available for this crispr