ID: 1202854764 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14_GL000225v1_random:43450-43472 |
| Sequence | GTGCTCCAGCGCAGCCAGGC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202854754_1202854764 | 20 | Left | 1202854754 | 14_GL000225v1_random:43407-43429 | CCCACAGGGGGCTTTCGTGAGGC | No data | ||
| Right | 1202854764 | 14_GL000225v1_random:43450-43472 | GTGCTCCAGCGCAGCCAGGCCGG | No data | ||||
| 1202854755_1202854764 | 19 | Left | 1202854755 | 14_GL000225v1_random:43408-43430 | CCACAGGGGGCTTTCGTGAGGCA | No data | ||
| Right | 1202854764 | 14_GL000225v1_random:43450-43472 | GTGCTCCAGCGCAGCCAGGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202854764 | Original CRISPR | GTGCTCCAGCGCAGCCAGGC CGG | Intergenic | ||