ID: 1202854765 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14_GL000225v1_random:43451-43473 |
Sequence | TGCTCCAGCGCAGCCAGGCC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202854754_1202854765 | 21 | Left | 1202854754 | 14_GL000225v1_random:43407-43429 | CCCACAGGGGGCTTTCGTGAGGC | No data | ||
Right | 1202854765 | 14_GL000225v1_random:43451-43473 | TGCTCCAGCGCAGCCAGGCCGGG | No data | ||||
1202854755_1202854765 | 20 | Left | 1202854755 | 14_GL000225v1_random:43408-43430 | CCACAGGGGGCTTTCGTGAGGCA | No data | ||
Right | 1202854765 | 14_GL000225v1_random:43451-43473 | TGCTCCAGCGCAGCCAGGCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202854765 | Original CRISPR | TGCTCCAGCGCAGCCAGGCC GGG | Intergenic | ||