ID: 1202854767

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:43455-43477
Sequence CCAGCGCAGCCAGGCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202854754_1202854767 25 Left 1202854754 14_GL000225v1_random:43407-43429 CCCACAGGGGGCTTTCGTGAGGC No data
Right 1202854767 14_GL000225v1_random:43455-43477 CCAGCGCAGCCAGGCCGGGCTGG No data
1202854759_1202854767 -10 Left 1202854759 14_GL000225v1_random:43442-43464 CCGTCCCCGTGCTCCAGCGCAGC No data
Right 1202854767 14_GL000225v1_random:43455-43477 CCAGCGCAGCCAGGCCGGGCTGG No data
1202854755_1202854767 24 Left 1202854755 14_GL000225v1_random:43408-43430 CCACAGGGGGCTTTCGTGAGGCA No data
Right 1202854767 14_GL000225v1_random:43455-43477 CCAGCGCAGCCAGGCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202854767 Original CRISPR CCAGCGCAGCCAGGCCGGGC TGG Intergenic
No off target data available for this crispr