ID: 1202854767 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14_GL000225v1_random:43455-43477 |
| Sequence | CCAGCGCAGCCAGGCCGGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202854759_1202854767 | -10 | Left | 1202854759 | 14_GL000225v1_random:43442-43464 | CCGTCCCCGTGCTCCAGCGCAGC | No data | ||
| Right | 1202854767 | 14_GL000225v1_random:43455-43477 | CCAGCGCAGCCAGGCCGGGCTGG | No data | ||||
| 1202854755_1202854767 | 24 | Left | 1202854755 | 14_GL000225v1_random:43408-43430 | CCACAGGGGGCTTTCGTGAGGCA | No data | ||
| Right | 1202854767 | 14_GL000225v1_random:43455-43477 | CCAGCGCAGCCAGGCCGGGCTGG | No data | ||||
| 1202854754_1202854767 | 25 | Left | 1202854754 | 14_GL000225v1_random:43407-43429 | CCCACAGGGGGCTTTCGTGAGGC | No data | ||
| Right | 1202854767 | 14_GL000225v1_random:43455-43477 | CCAGCGCAGCCAGGCCGGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202854767 | Original CRISPR | CCAGCGCAGCCAGGCCGGGC TGG | Intergenic | ||