ID: 1202857173

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:58750-58772
Sequence CAACCAGTCTGTGCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202857167_1202857173 -9 Left 1202857167 14_GL000225v1_random:58736-58758 CCCCTGTTCCAGTCCAACCAGTC No data
Right 1202857173 14_GL000225v1_random:58750-58772 CAACCAGTCTGTGCCAGGAGAGG No data
1202857161_1202857173 28 Left 1202857161 14_GL000225v1_random:58699-58721 CCACAGGGGTCTTTCATGTGCCA No data
Right 1202857173 14_GL000225v1_random:58750-58772 CAACCAGTCTGTGCCAGGAGAGG No data
1202857160_1202857173 29 Left 1202857160 14_GL000225v1_random:58698-58720 CCCACAGGGGTCTTTCATGTGCC No data
Right 1202857173 14_GL000225v1_random:58750-58772 CAACCAGTCTGTGCCAGGAGAGG No data
1202857166_1202857173 -6 Left 1202857166 14_GL000225v1_random:58733-58755 CCGCCCCTGTTCCAGTCCAACCA No data
Right 1202857173 14_GL000225v1_random:58750-58772 CAACCAGTCTGTGCCAGGAGAGG No data
1202857168_1202857173 -10 Left 1202857168 14_GL000225v1_random:58737-58759 CCCTGTTCCAGTCCAACCAGTCT No data
Right 1202857173 14_GL000225v1_random:58750-58772 CAACCAGTCTGTGCCAGGAGAGG No data
1202857165_1202857173 8 Left 1202857165 14_GL000225v1_random:58719-58741 CCAAGGAGCGAGGGCCGCCCCTG No data
Right 1202857173 14_GL000225v1_random:58750-58772 CAACCAGTCTGTGCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202857173 Original CRISPR CAACCAGTCTGTGCCAGGAG AGG Intergenic
No off target data available for this crispr