ID: 1202857480

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:59877-59899
Sequence GGCCCTCCATGGTGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202857480_1202857492 22 Left 1202857480 14_GL000225v1_random:59877-59899 CCCAGCTGCCACCATGGAGGGCC No data
Right 1202857492 14_GL000225v1_random:59922-59944 AGCTCTCTTTGCCGACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202857480 Original CRISPR GGCCCTCCATGGTGGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr