ID: 1202857887

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:63131-63153
Sequence GGCCCTCCATGGTGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202857877_1202857887 22 Left 1202857877 14_GL000225v1_random:63086-63108 CCAGGAGTCCGGCAAAGAGAGCT No data
Right 1202857887 14_GL000225v1_random:63131-63153 GGCCCTCCATGGTGGCAGCTGGG No data
1202857879_1202857887 14 Left 1202857879 14_GL000225v1_random:63094-63116 CCGGCAAAGAGAGCTAGAGGTCT No data
Right 1202857887 14_GL000225v1_random:63131-63153 GGCCCTCCATGGTGGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202857887 Original CRISPR GGCCCTCCATGGTGGCAGCT GGG Intergenic
No off target data available for this crispr