ID: 1202858189

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:64260-64282
Sequence AGCAAGGCTGCCCCGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202858189_1202858196 -8 Left 1202858189 14_GL000225v1_random:64260-64282 CCCTGTGCCGGGGCAGCCTTGCT No data
Right 1202858196 14_GL000225v1_random:64275-64297 GCCTTGCTGGGCTGGAGCACGGG No data
1202858189_1202858198 -7 Left 1202858189 14_GL000225v1_random:64260-64282 CCCTGTGCCGGGGCAGCCTTGCT No data
Right 1202858198 14_GL000225v1_random:64276-64298 CCTTGCTGGGCTGGAGCACGGGG No data
1202858189_1202858199 -3 Left 1202858189 14_GL000225v1_random:64260-64282 CCCTGTGCCGGGGCAGCCTTGCT No data
Right 1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG 0: 10
1: 10
2: 13
3: 69
4: 604
1202858189_1202858195 -9 Left 1202858189 14_GL000225v1_random:64260-64282 CCCTGTGCCGGGGCAGCCTTGCT No data
Right 1202858195 14_GL000225v1_random:64274-64296 AGCCTTGCTGGGCTGGAGCACGG No data
1202858189_1202858200 11 Left 1202858189 14_GL000225v1_random:64260-64282 CCCTGTGCCGGGGCAGCCTTGCT No data
Right 1202858200 14_GL000225v1_random:64294-64316 CGGGGACGGCCCTCACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202858189 Original CRISPR AGCAAGGCTGCCCCGGCACA GGG (reversed) Intergenic
No off target data available for this crispr