ID: 1202858196

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:64275-64297
Sequence GCCTTGCTGGGCTGGAGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202858190_1202858196 -9 Left 1202858190 14_GL000225v1_random:64261-64283 CCTGTGCCGGGGCAGCCTTGCTG No data
Right 1202858196 14_GL000225v1_random:64275-64297 GCCTTGCTGGGCTGGAGCACGGG No data
1202858180_1202858196 21 Left 1202858180 14_GL000225v1_random:64231-64253 CCCCACATCCTGGGGCAGGTTGG No data
Right 1202858196 14_GL000225v1_random:64275-64297 GCCTTGCTGGGCTGGAGCACGGG No data
1202858185_1202858196 13 Left 1202858185 14_GL000225v1_random:64239-64261 CCTGGGGCAGGTTGGGAGATACC No data
Right 1202858196 14_GL000225v1_random:64275-64297 GCCTTGCTGGGCTGGAGCACGGG No data
1202858184_1202858196 19 Left 1202858184 14_GL000225v1_random:64233-64255 CCACATCCTGGGGCAGGTTGGGA No data
Right 1202858196 14_GL000225v1_random:64275-64297 GCCTTGCTGGGCTGGAGCACGGG No data
1202858189_1202858196 -8 Left 1202858189 14_GL000225v1_random:64260-64282 CCCTGTGCCGGGGCAGCCTTGCT No data
Right 1202858196 14_GL000225v1_random:64275-64297 GCCTTGCTGGGCTGGAGCACGGG No data
1202858182_1202858196 20 Left 1202858182 14_GL000225v1_random:64232-64254 CCCACATCCTGGGGCAGGTTGGG No data
Right 1202858196 14_GL000225v1_random:64275-64297 GCCTTGCTGGGCTGGAGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202858196 Original CRISPR GCCTTGCTGGGCTGGAGCAC GGG Intergenic
No off target data available for this crispr