ID: 1202858198

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:64276-64298
Sequence CCTTGCTGGGCTGGAGCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202858184_1202858198 20 Left 1202858184 14_GL000225v1_random:64233-64255 CCACATCCTGGGGCAGGTTGGGA No data
Right 1202858198 14_GL000225v1_random:64276-64298 CCTTGCTGGGCTGGAGCACGGGG No data
1202858190_1202858198 -8 Left 1202858190 14_GL000225v1_random:64261-64283 CCTGTGCCGGGGCAGCCTTGCTG No data
Right 1202858198 14_GL000225v1_random:64276-64298 CCTTGCTGGGCTGGAGCACGGGG No data
1202858182_1202858198 21 Left 1202858182 14_GL000225v1_random:64232-64254 CCCACATCCTGGGGCAGGTTGGG No data
Right 1202858198 14_GL000225v1_random:64276-64298 CCTTGCTGGGCTGGAGCACGGGG No data
1202858189_1202858198 -7 Left 1202858189 14_GL000225v1_random:64260-64282 CCCTGTGCCGGGGCAGCCTTGCT No data
Right 1202858198 14_GL000225v1_random:64276-64298 CCTTGCTGGGCTGGAGCACGGGG No data
1202858185_1202858198 14 Left 1202858185 14_GL000225v1_random:64239-64261 CCTGGGGCAGGTTGGGAGATACC No data
Right 1202858198 14_GL000225v1_random:64276-64298 CCTTGCTGGGCTGGAGCACGGGG No data
1202858180_1202858198 22 Left 1202858180 14_GL000225v1_random:64231-64253 CCCCACATCCTGGGGCAGGTTGG No data
Right 1202858198 14_GL000225v1_random:64276-64298 CCTTGCTGGGCTGGAGCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202858198 Original CRISPR CCTTGCTGGGCTGGAGCACG GGG Intergenic
No off target data available for this crispr