ID: 1202858199

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:64280-64302
Sequence GCTGGGCTGGAGCACGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 10, 1: 10, 2: 13, 3: 69, 4: 604}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202858180_1202858199 26 Left 1202858180 14_GL000225v1_random:64231-64253 CCCCACATCCTGGGGCAGGTTGG No data
Right 1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG 0: 10
1: 10
2: 13
3: 69
4: 604
1202858189_1202858199 -3 Left 1202858189 14_GL000225v1_random:64260-64282 CCCTGTGCCGGGGCAGCCTTGCT No data
Right 1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG 0: 10
1: 10
2: 13
3: 69
4: 604
1202858185_1202858199 18 Left 1202858185 14_GL000225v1_random:64239-64261 CCTGGGGCAGGTTGGGAGATACC No data
Right 1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG 0: 10
1: 10
2: 13
3: 69
4: 604
1202858190_1202858199 -4 Left 1202858190 14_GL000225v1_random:64261-64283 CCTGTGCCGGGGCAGCCTTGCTG No data
Right 1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG 0: 10
1: 10
2: 13
3: 69
4: 604
1202858182_1202858199 25 Left 1202858182 14_GL000225v1_random:64232-64254 CCCACATCCTGGGGCAGGTTGGG No data
Right 1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG 0: 10
1: 10
2: 13
3: 69
4: 604
1202858184_1202858199 24 Left 1202858184 14_GL000225v1_random:64233-64255 CCACATCCTGGGGCAGGTTGGGA No data
Right 1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG 0: 10
1: 10
2: 13
3: 69
4: 604
1202858193_1202858199 -10 Left 1202858193 14_GL000225v1_random:64267-64289 CCGGGGCAGCCTTGCTGGGCTGG No data
Right 1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG 0: 10
1: 10
2: 13
3: 69
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202858199 Original CRISPR GCTGGGCTGGAGCACGGGGA CGG Intergenic
900000286 1:11056-11078 GCCGGGCTGGGGCGGGGGGAGGG + Intergenic
900095623 1:938966-938988 GCTGAGCTGGAGCAGGGGCTGGG + Intronic
900096165 1:940997-941019 GCTGGTCTCGGGCACGGGGCAGG - Intronic
900121498 1:1050334-1050356 GTGGGGCAGGAGCAGGGGGAAGG + Intronic
900151379 1:1180645-1180667 CCTGGGCCGGAGCACAGGGCAGG + Intronic
900584054 1:3424054-3424076 GCTGGGCTGGGCGACGGTGAAGG - Intronic
900624667 1:3602739-3602761 GCTGGCCTGGGGCACTGGCATGG - Intronic
900947081 1:5837136-5837158 GGTGGGCAGGAGGAGGGGGAGGG - Intergenic
901207498 1:7505437-7505459 GGTGGGCTGGAGCTGGGGGAGGG - Intronic
901266197 1:7912779-7912801 CCTGGGATGGAGCTTGGGGAGGG - Intergenic
901621478 1:10591836-10591858 GCTGGGCAGGGGCAGGGGGCGGG - Intronic
901624802 1:10617832-10617854 GCTGGGTGGGGGCACGGGGGTGG - Intronic
902374763 1:16025177-16025199 GCTGGCCTGGAGCTGGAGGAAGG - Intronic
902376815 1:16033745-16033767 GCTGGGCTGGAGGGAGGGGCAGG - Exonic
902379717 1:16046971-16046993 GCTGGCCTGGAGCAGGAGGCAGG - Intronic
902381983 1:16057003-16057025 GCTGGGCTGGAGGGAGGGGCAGG - Exonic
902652209 1:17844305-17844327 GCAGGGCTGGGGCTCGGGGTTGG - Intergenic
902764804 1:18607059-18607081 GCTGGCCTGCAGGAAGGGGACGG + Intergenic
902770435 1:18642724-18642746 GCTGGGGTGGAGCAGGGGGAGGG + Intronic
903619683 1:24688925-24688947 GATGGGCTGGAGCCAGTGGACGG - Intergenic
903778830 1:25809168-25809190 GCTGGCCTGGAGCACCGGGGAGG + Intronic
904266872 1:29323349-29323371 GCTGGGCATAAGCACGGAGAGGG - Exonic
904267758 1:29327367-29327389 GCTGGGCTGGGGCAATGGGACGG - Intergenic
904312233 1:29636238-29636260 GCTGGGCAGCTGCACAGGGATGG + Intergenic
904449969 1:30604903-30604925 GCTAGGGTGGAGAGCGGGGAGGG - Intergenic
904811968 1:33169265-33169287 GCTGGGATGGAGTTAGGGGAGGG - Intronic
905031905 1:34890083-34890105 GCTGGTCTGAAGTACAGGGATGG + Intronic
905189781 1:36224585-36224607 GCTGGTCAGGGGCTCGGGGAAGG + Intronic
905300133 1:36981309-36981331 GCTGGGCTGGGCCTCTGGGAGGG + Intronic
906057699 1:42929553-42929575 GCTTGGCTGGGGCACAGGAAGGG + Intronic
906282813 1:44565805-44565827 ACTGGGTTGCAGGACGGGGATGG - Intronic
906610294 1:47196923-47196945 GCTGGCCTGGAGCCCTGGGTAGG - Intergenic
906662458 1:47592865-47592887 GAAGGGCTGGCGCACGGGGAGGG + Intergenic
907399561 1:54216515-54216537 GCTGGAGTGGAGCACTGGGCAGG - Intronic
907430230 1:54406930-54406952 GCCGGGCTGGAGTCTGGGGAGGG - Intronic
907440128 1:54473870-54473892 GCTTGGCTTGGGCACTGGGAGGG - Intergenic
907451499 1:54548351-54548373 GGTGGGCTGGGGCAGCGGGAGGG + Intronic
908163244 1:61432453-61432475 GGTGGGCAGGAGCCCGGGAATGG - Intronic
908251438 1:62268985-62269007 GCTGGGCTGGAGCAGTCTGAAGG - Intronic
910186223 1:84543496-84543518 GCAAGGCTGGAGCAGGAGGAAGG + Intergenic
910446504 1:87303454-87303476 GCTGGGCTGGACCGCATGGAAGG + Intergenic
912370530 1:109170746-109170768 GCTGGGCTGCAGCATGCAGAGGG + Intronic
912386897 1:109275307-109275329 GATGGCCTGGGGCAAGGGGAAGG - Exonic
912554970 1:110509218-110509240 GCTGGGATGGGGCATGGGGGAGG - Intergenic
912841603 1:113043993-113044015 GCTGAGGTGGAGTAGGGGGAGGG + Intergenic
913223800 1:116680890-116680912 GGTGGGCTGGAGCTCAGTGAGGG + Intergenic
913942321 1:125119840-125119862 GCTGGGCTCCAGCACCGGGCTGG + Intergenic
914964062 1:152237477-152237499 GCTGGGATGGAGGGAGGGGAGGG + Intergenic
915106947 1:153540691-153540713 GCTGGGCTGGAACTGGGTGATGG + Intronic
915216695 1:154345182-154345204 GCTGGGCTTGAGGCTGGGGAGGG + Intronic
915406095 1:155660632-155660654 GCTGGGCTGGAGAGAGGGGCTGG + Exonic
915419256 1:155766428-155766450 GCTGGGCTGGAGAGAGGGGCTGG + Exonic
916470773 1:165120051-165120073 GCTGGTCTGCAGCACTGGGCAGG - Intergenic
916825023 1:168434878-168434900 GCTGGGGAAGAGCATGGGGATGG + Intergenic
916982678 1:170155012-170155034 GCAGAGCAGGAGCAAGGGGAGGG - Intronic
917194348 1:172449983-172450005 GCTGGAGTGGAGAATGGGGAAGG + Intronic
920073548 1:203320960-203320982 GCTGGGGAGGAGCTGGGGGAGGG - Intergenic
920340038 1:205269896-205269918 GCTGGGCTGCAGGAGGGGGTGGG - Intronic
920555326 1:206900119-206900141 GCTGAGCTGGCCCATGGGGAGGG - Intronic
921317145 1:213903208-213903230 GCTGGGCAGGGGCCTGGGGATGG + Intergenic
922718700 1:227889542-227889564 GAGTGGCTGGAGCATGGGGAGGG - Intergenic
922887526 1:229031500-229031522 CCTGGGCTGGACCCTGGGGACGG + Intergenic
923842827 1:237692538-237692560 ACTGGGCTGGGACACGAGGACGG - Intronic
924207158 1:241725397-241725419 GCGGGGCTGGGGGACGTGGAGGG - Intronic
924502813 1:244653027-244653049 GCGGGGCTTGAGCAAGGGGCGGG - Exonic
924511207 1:244730465-244730487 GCGGGGCTGGCGCGCGGGGGCGG + Intergenic
1063371380 10:5525017-5525039 GCCGGGCTGCGGCACTGGGAGGG + Exonic
1064022844 10:11823495-11823517 GCAGGGCTGGAGCGACGGGAGGG + Intronic
1065814058 10:29469228-29469250 TGTGGGCTAGGGCACGGGGAGGG - Intronic
1066478694 10:35773809-35773831 GCATGGCTGGAACACGGAGAAGG + Intergenic
1067065231 10:43100743-43100765 GGTGGGGTGGGGCACGGGGTGGG - Intronic
1067171075 10:43906467-43906489 GTTGGGAAGGATCACGGGGAAGG + Intergenic
1067278118 10:44852092-44852114 GCAGGGCCGGAGTACAGGGAAGG + Intergenic
1067851869 10:49759694-49759716 GCTGTGCTGGAGCAGAGGAAGGG - Intronic
1068744403 10:60513932-60513954 GCTGAGGTGGAGGAAGGGGAAGG - Intronic
1069652464 10:70059763-70059785 GGTGCGGTGGACCACGGGGAGGG - Intronic
1069833709 10:71295967-71295989 GCTGGGCTGATGGATGGGGAGGG + Intronic
1069957813 10:72062346-72062368 GCTGGGCTGGAGGACACGGCTGG + Exonic
1070642379 10:78179176-78179198 ACTGGGCTTGAGCAGTGGGAAGG + Intergenic
1070733794 10:78849898-78849920 GTGTGGCTGAAGCACGGGGAGGG - Intergenic
1070823279 10:79375639-79375661 TCTGGGATGGGGCATGGGGAGGG + Intergenic
1071553376 10:86584415-86584437 GCAGCCCTGGGGCACGGGGAAGG + Intergenic
1072111393 10:92323574-92323596 GGTGGCCAGGAGCTCGGGGAGGG - Intronic
1073179796 10:101576884-101576906 ACTGGGCTGGAGCAGGGAGCAGG + Intronic
1073289640 10:102407175-102407197 GCTAGGATGGGGCATGGGGAAGG - Intronic
1073460998 10:103665830-103665852 GCTTGGCAGGAGCATGGAGAAGG + Intronic
1073480469 10:103783385-103783407 GCGGGGCTGGACCACGGTGGGGG + Intronic
1074566551 10:114584226-114584248 GCTGGGCTGGAGCAAACGCAGGG + Intronic
1074843006 10:117374334-117374356 GGTGAGCTGGAGGTCGGGGAGGG - Exonic
1074921673 10:118020585-118020607 GCTGGGATGGGGCTGGGGGAAGG - Intronic
1075086798 10:119419114-119419136 GGTGGGCTGGAGAAGGGAGAGGG - Intronic
1075144121 10:119868895-119868917 GCTGGGATGGAGTATGAGGAGGG + Intronic
1075179260 10:120195721-120195743 GGTGTGCTTGAGCACTGGGAGGG + Intergenic
1075204136 10:120432132-120432154 GCTTGGCTGGAGTTCAGGGAAGG + Intergenic
1075325982 10:121532609-121532631 GCTGAGCTGGGGCCAGGGGACGG - Intronic
1075511201 10:123074125-123074147 GCTGGGCTGGACCACGCTGTGGG + Intergenic
1075568601 10:123522098-123522120 GCTGGGCTGAATCCCAGGGATGG + Intergenic
1076921018 10:133454667-133454689 GCTGGGCGGGAGGCAGGGGAGGG + Intergenic
1076947818 10:133664481-133664503 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076948808 10:133667791-133667813 GCTGGGCTGCAGCGCGGGGGCGG - Exonic
1076949792 10:133671090-133671112 GCTGGGCTGCAGCGCGGGGGCGG - Intronic
1076950776 10:133674389-133674411 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076951766 10:133677699-133677721 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076952755 10:133681009-133681031 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076953739 10:133684308-133684330 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076954723 10:133740660-133740682 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076955712 10:133743970-133743992 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076956702 10:133747280-133747302 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076957689 10:133750589-133750611 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076958674 10:133753888-133753910 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076959663 10:133757198-133757220 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1076960647 10:133760497-133760519 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
1077090706 11:777165-777187 GGTGGGATGGAGCTCGGGGCGGG - Intronic
1077232061 11:1462212-1462234 GCTGGGGTGAAGCACGGCGGCGG - Intronic
1077434216 11:2531018-2531040 GCTGGGCAGGAGCACCTGGGTGG - Intronic
1077436162 11:2540184-2540206 GCTGGGCAGCAGCCTGGGGAGGG + Intronic
1077545399 11:3167040-3167062 GCTGGGGTGGAGCAGGACGAGGG + Intergenic
1078009997 11:7565628-7565650 GATGAGATGGAGCACCGGGAAGG - Exonic
1079129344 11:17738328-17738350 GAGGGGCTGGAGGAGGGGGATGG + Intronic
1081637547 11:44730424-44730446 GCTGGGGTGCAGCACAGGGAGGG + Intronic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1081659287 11:44878137-44878159 TCTGGGGTGGAGCTGGGGGAAGG - Intronic
1082006147 11:47420242-47420264 GGTGAGCAGGAGCACGGGCAGGG - Exonic
1083262055 11:61528466-61528488 GCTGAGCTGGAGCTTGGGGCAGG - Intronic
1083620405 11:64046500-64046522 CCTGGGCTGGAGCACAGCGCAGG - Intronic
1083672286 11:64306056-64306078 GCCGGGGTGGAAGACGGGGAGGG + Intronic
1083746749 11:64741358-64741380 GCTGGCCTGGAGGAGGGGGCAGG - Intronic
1083773968 11:64884140-64884162 GCTGGGCCACAGGACGGGGAGGG - Intronic
1083889532 11:65588984-65589006 GCTGGGCTGGGTCACACGGATGG + Intronic
1084459825 11:69290438-69290460 GCTGGGGTGGGGCATGGAGAGGG + Intergenic
1084938001 11:72597474-72597496 GCTGGGCAGGGGCAGGGGCAGGG - Intronic
1084963295 11:72728970-72728992 GCAGGGGTGGAGGGCGGGGAGGG + Intronic
1084973065 11:72781789-72781811 GCGGGGCTGGGGCCCGGGGCGGG - Intronic
1085012767 11:73152812-73152834 GGTGGGATGGAACACTGGGAGGG + Intergenic
1085271831 11:75274261-75274283 GCTGGGCTGGAGATCAGGGCTGG - Intronic
1085391320 11:76183727-76183749 GCTGAGCTGGAGGGCTGGGAGGG - Intergenic
1085391766 11:76185771-76185793 TTTTGGCTGGAGCACTGGGAAGG - Intergenic
1085527161 11:77170927-77170949 GTTTGGCTGGAGCAACGGGAAGG + Intronic
1088579062 11:111299058-111299080 GGTAGGCTGGAGCGCGGAGAGGG + Intronic
1088971641 11:114779509-114779531 GCTGAGCTGGCACCCGGGGATGG - Intergenic
1089348337 11:117806262-117806284 GTTGGGCTTGAGCAATGGGAAGG + Intronic
1089442717 11:118530580-118530602 GGTGGGCTGGGGCTCGGGCAAGG + Intronic
1089786887 11:120914009-120914031 GCTCGGCTGTCACACGGGGAAGG - Intronic
1089905027 11:122029892-122029914 GCTGGGCTGGAGCATAGGGCAGG - Intergenic
1090188266 11:124752044-124752066 GCCGGGCGGGACCACGGCGAGGG - Intronic
1090269171 11:125373960-125373982 GCTGGGCTGGTGGATGGGGTGGG + Intronic
1090386375 11:126359759-126359781 GCTGGGAGGGCCCACGGGGAAGG - Intronic
1090635146 11:128686426-128686448 CCTGGCCTGAAGCCCGGGGACGG + Intergenic
1090703455 11:129316132-129316154 GCTGGGGTGGAGCCCAGCGACGG - Intergenic
1091467473 12:697690-697712 GGTGGGCTGGAGCGAGAGGAAGG + Intergenic
1093063576 12:14632768-14632790 GGTAGGCTGAAGCACTGGGAGGG - Intronic
1094818710 12:34209017-34209039 GCTGGGCTGGAGCAGGGCAATGG + Intergenic
1095199171 12:39362071-39362093 ACAGGGCTGGAGCAGGAGGAAGG - Intronic
1095687480 12:45051504-45051526 GCTGGCCTGGAGCGCCCGGAGGG + Intergenic
1096189336 12:49605151-49605173 GCAGGGCTGGGGCCCGGGAAGGG - Intronic
1096256114 12:50063333-50063355 GCTGAGCAGCAGCAAGGGGAGGG + Intronic
1096386446 12:51197928-51197950 GCTGGGCTGGTGGCCGGGGTTGG + Exonic
1099198670 12:79649878-79649900 ACTGGGCTGTAGCAGGGGGTAGG + Intronic
1102151895 12:110694410-110694432 GCTGTCCTGGAGCCCAGGGATGG - Intronic
1102426442 12:112847895-112847917 GCTGGGCTGGAGCAGGGCTTTGG + Intronic
1102528989 12:113532405-113532427 GCAGGGCTGGAGTATGTGGATGG - Intergenic
1103321871 12:120096854-120096876 GCTGGGGAGGGGCGCGGGGAGGG + Exonic
1103342035 12:120225904-120225926 TCTGGGCAGGAGCATGGGGTAGG - Intronic
1103367048 12:120390917-120390939 GTGTGGCTGGAGCACTGGGAGGG - Intergenic
1103400496 12:120640460-120640482 GCGGAGCGGGAGCACGAGGAGGG - Intergenic
1103526951 12:121575457-121575479 CCTGATCTGGAGCAAGGGGAAGG + Intronic
1103579802 12:121906244-121906266 GGTGGGCTGGAGGATGGAGAAGG + Intronic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1104610062 12:130220344-130220366 GCTGGGCTGGAGAGGAGGGAAGG + Intergenic
1104789249 12:131471620-131471642 CCTGGGATGGAGGACGTGGATGG + Intergenic
1104893634 12:132151667-132151689 GCTGGGCTGGAGCTGGGGCGGGG + Intronic
1108858920 13:54829576-54829598 GCTGCACAGGAGCCCGGGGAGGG + Intergenic
1110249443 13:73365108-73365130 ACTGGGCTGGAGCTGGGGCAGGG + Intergenic
1110558610 13:76886631-76886653 GTTGGGCGGGACCACGGGGCGGG - Intergenic
1112109764 13:96283311-96283333 GCTGGGATGGAGAACTGGAAAGG - Intronic
1112290837 13:98143154-98143176 GCTCGGCTGGGGCGCGGGGCGGG + Intronic
1113518741 13:110922852-110922874 GCTGGAGTGAAGCAGGGGGAAGG - Intergenic
1113652314 13:112042759-112042781 GCAGGGCTGGGGCAAGGGCAAGG - Intergenic
1113772291 13:112917884-112917906 GCCGGCCTGGAGCAGGGGGGTGG - Intronic
1113802869 13:113095592-113095614 GATGGCCTGGAGCAAGAGGACGG - Intronic
1113802878 13:113095639-113095661 GATGGCCTGGAGCAGGAGGACGG - Intronic
1113843481 13:113373213-113373235 GCTGGGCTGGAGCTCCCGGCAGG + Intergenic
1113932099 13:113973988-113974010 GCTGGGCTGGAGGATGGAGAAGG - Intergenic
1113991482 14:16030723-16030745 GCTAGGCTGGAGCGGTGGGACGG + Intergenic
1115614256 14:35078310-35078332 ACTGGGCTGGAGGAGGGGAATGG - Intronic
1117830034 14:59741160-59741182 GCTTGGCTGGAGGAGGGGGAAGG - Intronic
1119062034 14:71484986-71485008 GCTGGGATGGAGTAAGGGGAGGG - Intronic
1119218069 14:72884535-72884557 GCCAGGCTGGAGGAAGGGGAAGG + Intronic
1119224519 14:72934626-72934648 CCTGGGCTGGAGGTGGGGGAGGG - Intronic
1119320865 14:73729585-73729607 GCGGGGCTGGGGCACTGGGCAGG - Intronic
1119904967 14:78293448-78293470 GGTGGGATGGAGTAGGGGGATGG - Intronic
1120186470 14:81398446-81398468 GGTGGGCTGGAGTAGGGGTATGG + Exonic
1120766016 14:88326853-88326875 CCCGGGCTGGAGCGTGGGGAGGG - Intronic
1120867040 14:89304286-89304308 GCTGAGCTGGAGCCCGGGAAGGG + Intronic
1121212807 14:92221707-92221729 TCTGGGATGGAGCATGAGGAGGG - Intergenic
1121555096 14:94830441-94830463 GCTTGGCTGGGGCAGGGGCAAGG - Intergenic
1121738655 14:96236262-96236284 TCTGGACTGGAGCACTGTGATGG - Intronic
1122115007 14:99523201-99523223 GCTGGGCTGGGGCAGGGGCAAGG + Intronic
1122544202 14:102513258-102513280 ACTGTGCTGGAGCAGGCGGAGGG + Intergenic
1122609125 14:102969317-102969339 GCTGGGCTGGAGCAGGCAGGAGG + Intronic
1122805027 14:104252240-104252262 GCTGGGCTGGAGCCTGCAGATGG + Intergenic
1122813739 14:104301985-104302007 GCTGGGCTTGAGAACAGGGCCGG - Intergenic
1122853346 14:104548340-104548362 GCTGGGCTGGGGCCAGGGGCTGG - Intronic
1122888229 14:104720068-104720090 GCTGGGGAGGAGCACGGGGAAGG - Intronic
1122916934 14:104863806-104863828 CCTGGGCTGGAGGGCGGGGGGGG - Intergenic
1122931467 14:104934545-104934567 GCTAGGCTGGAGTTCAGGGATGG + Exonic
1123039241 14:105483657-105483679 GCTGGCCTGCAGCCCCGGGAGGG + Intergenic
1123059446 14:105587911-105587933 GCGAGGCGGGGGCACGGGGAAGG - Intergenic
1202848482 14_GL000225v1_random:1233-1255 GCTGGGCTGGAGCACAGGGACGG - Intergenic
1202849691 14_GL000225v1_random:9026-9048 GCTGGGCTGGAGCACGGGGATGG - Intergenic
1202852581 14_GL000225v1_random:30708-30730 GCTGGGCTGGAGCAGGGGGACGG - Intergenic
1202853651 14_GL000225v1_random:37000-37022 GCTGGGCTGGAGCACGTGGACGG - Intergenic
1202854759 14_GL000225v1_random:43442-43464 GCTGCGCTGGAGCACGGGGACGG - Intergenic
1202858199 14_GL000225v1_random:64280-64302 GCTGGGCTGGAGCACGGGGACGG + Intergenic
1202860680 14_GL000225v1_random:79398-79420 GCTGGGCTGGAGCTCGGGGACGG + Intergenic
1202862182 14_GL000225v1_random:89856-89878 GCTGGGCTGGAGCACGGGGTCGG + Intergenic
1202864263 14_GL000225v1_random:104913-104935 GCTGGGCTGGAGCACGGGGACGG + Intergenic
1202868228 14_GL000225v1_random:136411-136433 GCTGGGCTGGAGCACGGGGACGG + Intergenic
1202921974 14_KI270723v1_random:35308-35330 GCTGGGCTGGAGCACGGGGACGG - Intergenic
1202922954 14_KI270724v1_random:2305-2327 GCTGGGCTGGAGCACGGGGACGG + Intergenic
1124215553 15:27805197-27805219 GCTGGCCTGGAGCAGGTGAAAGG + Intronic
1124355967 15:28995046-28995068 GCTGGGGTGGAACAGGAGGAGGG - Intronic
1124427083 15:29571062-29571084 GCGGGGCTCGCGCCCGGGGACGG - Intergenic
1125513186 15:40303649-40303671 TCTGGGCAGGAGGACGGGAAGGG - Intronic
1125732412 15:41900620-41900642 GGTGGGCTGCAGAACGGGGTGGG - Exonic
1128028723 15:64460976-64460998 GCTGGGGCGGAGCGAGGGGAAGG + Intronic
1128095305 15:64949684-64949706 GCTTGGCTGGAGCATGGAGAAGG + Intronic
1128262160 15:66240078-66240100 GCTGGGGTGGAGCTCAGGGCAGG - Intronic
1128355359 15:66922718-66922740 GCTGGGCTGGAGGAGGGAGAGGG + Intergenic
1128738279 15:70065986-70066008 GCTGGGCTGGGGCAGAGGGTGGG - Intronic
1128780052 15:70353366-70353388 GCTGGGCAGGGGCATGTGGAAGG + Intergenic
1129509429 15:76109799-76109821 GCTGGGCTGAAGCAGGAGGCTGG + Intronic
1130322829 15:82854795-82854817 GCTGCGCTGCAGGACAGGGACGG + Exonic
1130553166 15:84904940-84904962 GCTTGGCTGTAGCCTGGGGAAGG - Intronic
1131484418 15:92808610-92808632 GCTGGGGAGGCGCACGGGGCGGG - Intronic
1132118810 15:99158937-99158959 GCCTGGCAGGAGCATGGGGAGGG + Intronic
1132422207 15:101680085-101680107 GCTGGGTTGGGGGAGGGGGATGG + Intronic
1132453221 15:101979889-101979911 GCCGGGCTGGGGCGGGGGGAGGG - Intergenic
1132652764 16:1029040-1029062 GATGGGCTGGGGCAGGGGCAGGG - Intergenic
1132720462 16:1313153-1313175 GCAGGGCAGGAGCATGGGGTAGG - Intronic
1133601340 16:7343007-7343029 GCTGGGTTGCAGGACGGGGAGGG + Intronic
1133854275 16:9534994-9535016 GCTGAGCAGGAGCAGTGGGAAGG - Intergenic
1134048998 16:11123827-11123849 GGTGGCCTGGAGGATGGGGAAGG - Exonic
1134091138 16:11392285-11392307 CCTGGGCTGGGACACAGGGAAGG - Intronic
1134388235 16:13794157-13794179 GCTTGGCTGGAGGAGGGGCAGGG - Intergenic
1134438900 16:14285831-14285853 GCTGGGCGGGCGCACGGGAGCGG + Intergenic
1134551505 16:15141019-15141041 GCTGGGCGGGTGCTCAGGGATGG - Intergenic
1134551518 16:15141054-15141076 GCTGGGCGGGTGCTCAGGGATGG - Intergenic
1134551534 16:15141099-15141121 GCTGGGCGGGTGCTCAGGGATGG - Intergenic
1135478416 16:22799303-22799325 GCTGGGCTGTAGCATGGCCAGGG + Intergenic
1136137165 16:28263496-28263518 GGTAGGCAGGAGCACGGGGAGGG + Intergenic
1136181313 16:28554273-28554295 GCGGGGCCGGGGCTCGGGGAGGG + Intronic
1136573506 16:31110131-31110153 GCTGGGCCAGAGCAGGGTGAGGG + Intronic
1136683165 16:31979456-31979478 GCTGGGAGGGAGCACAGAGAGGG - Intergenic
1136710945 16:32235739-32235761 GCTTGTCAGGAGCATGGGGATGG + Intergenic
1136756963 16:32693672-32693694 GCTTGTCAGGAGCATGGGGATGG - Intergenic
1136777487 16:32879578-32879600 GCTGGGCTGGGGCATGGTGGCGG - Intergenic
1136783798 16:32923012-32923034 GCTGGGAGGGAGCACAGAGAGGG - Intergenic
1136811146 16:33176703-33176725 GCTTGTCAGGAGCATGGGGATGG + Intergenic
1136817622 16:33286783-33286805 GCTTGTCAGGAGCATGGGGATGG + Intronic
1136824186 16:33343312-33343334 GCTTGTCAGGAGCATGGGGATGG + Intergenic
1136885986 16:33930794-33930816 GCTGGGAGGGAGCACAGAGAGGG + Intergenic
1136893137 16:33981936-33981958 GCTGGGCTGGGGCATGGTGGTGG + Intergenic
1136910672 16:34141847-34141869 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1136924194 16:34356312-34356334 TGTGGGCTGGAGCAGAGGGAAGG - Intergenic
1136980379 16:35055494-35055516 TGTGGGCTGGAGCAGAGGGAAGG + Intergenic
1137017454 16:35392321-35392343 GCTTGCCAGGAGCATGGGGATGG - Intergenic
1138179352 16:54931488-54931510 GCCGGGCGGGAGGACGGGGGCGG + Intronic
1138348005 16:56331679-56331701 TCTGGGATGGAGCTTGGGGACGG - Intronic
1138577396 16:57916726-57916748 GCAGGGGTGGTGCACGGGGCTGG + Intronic
1139352628 16:66346923-66346945 GCTGGGAGGGAGCACTGGGATGG - Intergenic
1139478544 16:67215640-67215662 GCAGGGCTGGAGGAAGGAGAAGG - Intronic
1140412935 16:74752427-74752449 GCATTGCTGGAGCATGGGGAGGG - Intronic
1140509871 16:75499169-75499191 GTTGGGCTGGGGCAGGTGGACGG + Intergenic
1140515663 16:75539378-75539400 GTTGGGCTGGGGCAGGTGGACGG + Exonic
1141150861 16:81563902-81563924 GCTAGGCTGCAGCATGGGGTTGG - Intronic
1141589105 16:85055990-85056012 GCTGAGCTGCAGCACTGGCAAGG - Intronic
1141644643 16:85360626-85360648 GCGGGGCGGGTGCAGGGGGAGGG + Intergenic
1141737443 16:85862912-85862934 GCTGGCTTGGGGCACGGGGGTGG + Intergenic
1141961481 16:87412109-87412131 GCCGGGCTGGAGCTGGGGGCTGG + Exonic
1141972377 16:87492541-87492563 GCTGGGCACGGGCGCGGGGAAGG - Intergenic
1142395196 16:89828196-89828218 GCTGGGCAGGACCGGGGGGAGGG - Intronic
1203059112 16_KI270728v1_random:954023-954045 GCTTGTCAGGAGCATGGGGATGG - Intergenic
1203079900 16_KI270728v1_random:1141687-1141709 GCTGGGCTGGGGCATGGTGGCGG - Intergenic
1203086455 16_KI270728v1_random:1187014-1187036 GCTGGGAGGGAGCACAGAGAGGG - Intergenic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1142494299 17:298200-298222 GCAGAGCTGGAGGACGTGGACGG - Intronic
1142836858 17:2593858-2593880 GCTGGGCCCGGGCCCGGGGAGGG - Exonic
1142940969 17:3379588-3379610 GCAGGCCTGGAGCTCAGGGAAGG + Intergenic
1143443754 17:6995640-6995662 TCTGGGCTGGGACCCGGGGAAGG - Intronic
1143783372 17:9240735-9240757 GCTGGGCAGGGGCAGGGGCAGGG - Exonic
1144451816 17:15387026-15387048 GCAGGGCTGGGTCGCGGGGAAGG + Intergenic
1144467796 17:15510224-15510246 GCTGGGCTGGAGGAAGATGATGG + Intronic
1144708855 17:17387481-17387503 GCTGGGCTGGAGCTAAGGCAAGG + Intergenic
1144940170 17:18933330-18933352 GCCGGGCTGGGGCAGGAGGATGG + Intergenic
1145712504 17:26990548-26990570 GCTGGGCTGGATGGTGGGGAGGG + Intergenic
1145903998 17:28506487-28506509 GCCGGGCTGGGGCACGGGGAGGG + Intronic
1145988292 17:29062242-29062264 GCTGGGCAGGGGCTGGGGGAAGG - Intergenic
1145993309 17:29091949-29091971 GCTGGGCAGGGGGAAGGGGAAGG + Intronic
1146185144 17:30719800-30719822 GCTGAGCTGGAGGATGGGGCAGG + Intergenic
1146657748 17:34645030-34645052 GCAGGGCTGGAGCACAGAGGGGG + Intergenic
1146666991 17:34711835-34711857 GCTGGGCTGCAGCCCGGTGTTGG - Intergenic
1146693255 17:34891043-34891065 GGGTGGCTGGAGCAAGGGGAGGG - Intergenic
1147144073 17:38475165-38475187 GCTGGGAGGGAGCACAGAGAGGG - Intronic
1147578004 17:41613615-41613637 GCAGGGCTGGCCCTCGGGGAAGG - Intronic
1148460668 17:47837543-47837565 ACTGGGCAGGAGGACAGGGAGGG - Exonic
1148550048 17:48544735-48544757 GCCGGGCTGGAGGCTGGGGAAGG + Exonic
1148722361 17:49763466-49763488 GCTGGACTATTGCACGGGGAGGG - Intronic
1148742070 17:49898589-49898611 GCTGGGCTGGGGCTGGGGGGAGG - Intergenic
1148744466 17:49910603-49910625 GCTGGGCCGGAGCTCGGGGAGGG - Intergenic
1148860143 17:50600436-50600458 GCTGGGCTGGAGGCAGGGGTGGG + Intronic
1149614813 17:57988433-57988455 GCTGGGGTGGGGCCCGGGGCGGG + Intergenic
1150135610 17:62693264-62693286 TCTGGTTTGGAGCAAGGGGAAGG + Exonic
1150221379 17:63497499-63497521 GGTGGTCTGGAGGACTGGGAGGG - Intronic
1151291859 17:73156258-73156280 GATGGGCAGGAGGATGGGGAGGG + Intergenic
1151473351 17:74331385-74331407 GCTGGGCTGGGCCACCGTGAGGG + Intronic
1151562475 17:74878025-74878047 GCTCAGATGGAGCAGGGGGAAGG + Exonic
1151719342 17:75846654-75846676 GCTGTGCTGGGGCTTGGGGAGGG - Exonic
1151892033 17:76956638-76956660 GCAGGGCCAGAGCACAGGGAAGG - Intergenic
1151985512 17:77540790-77540812 GCTGGGCTGGGCATCGGGGAAGG - Intergenic
1152224667 17:79087207-79087229 GCTGGGCTGGCGCGGGGGGCAGG - Intronic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152462534 17:80449143-80449165 GCTGGGCTGGAGAGACGGGAAGG - Intergenic
1152569691 17:81116255-81116277 GAAGGCCGGGAGCACGGGGATGG + Exonic
1152596346 17:81239505-81239527 GCTGGGAGGGAGGACGGTGACGG + Intronic
1152662129 17:81547363-81547385 GCCGAGCTGGTCCACGGGGATGG + Exonic
1152678302 17:81652982-81653004 GCAGGGATGGAGGAGGGGGAAGG - Intronic
1152884095 17:82838503-82838525 GCTCGGCTGGAGCATTGTGAAGG + Intronic
1152917699 17:83050703-83050725 CCTCTGCCGGAGCACGGGGAAGG + Intronic
1153584216 18:6604689-6604711 GCTGGGCTGGCGGACAGGTAAGG - Intergenic
1153664054 18:7352258-7352280 GATGGCCTGGAGCACAGGGCAGG - Intergenic
1157923088 18:51733787-51733809 GCTGGCCTGGAGTAGGGGGAAGG + Intergenic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1158881015 18:61779709-61779731 GCTGGGATGGAGCTGGGGGTTGG - Intergenic
1158954379 18:62524442-62524464 GCCGGGCTGGGGCTCGGGCAAGG - Intronic
1160322650 18:77910976-77910998 GCTGGACTGGGGGACGGGGATGG - Intergenic
1160450889 18:78965372-78965394 GGTGGGCGGGAGCAGAGGGACGG - Intergenic
1160451372 18:78968616-78968638 GCTGGGCTGGCGCCCCGAGACGG + Intergenic
1160763552 19:797536-797558 GCAGGGCTGCGGCGCGGGGAGGG - Intronic
1160906915 19:1455911-1455933 GCAGGGCTGGATCAGGGAGAAGG + Intronic
1160923815 19:1533476-1533498 GCTGTGCTGGTGACCGGGGAGGG + Intronic
1161007012 19:1941874-1941896 GGTGGGCTTGAGCACTGGGTGGG - Intronic
1161156259 19:2733180-2733202 GCTGAGCAGGCGCACGGGGCTGG + Exonic
1161221285 19:3119364-3119386 GCCGGGCTGCGGCATGGGGAGGG + Intronic
1161310552 19:3591683-3591705 ACTGGGCTGCAGGATGGGGATGG - Exonic
1161363955 19:3868066-3868088 GCTGGGCAGGAGGAGGGGAAGGG - Intronic
1161364049 19:3868402-3868424 GCTGGGCAGGAGGAGGGGAAGGG - Intronic
1161407927 19:4100871-4100893 GCTGCGCAGGAGAACTGGGAGGG + Intronic
1161684544 19:5696398-5696420 GCTGGCCAGGGGCACGGCGAGGG - Intronic
1161868735 19:6854108-6854130 GCAGGGCTGGGTGACGGGGAGGG + Intronic
1162217283 19:9146999-9147021 GCAGGGCTGGAGCAAGGGTGAGG + Intronic
1162369832 19:10271872-10271894 GCTGGGCTGGAGCTGGGGGAGGG - Intronic
1162583706 19:11546305-11546327 GCTGGGCTGGAGAGCGGGAGTGG + Intronic
1162770415 19:12946027-12946049 GCCGGGCCGGAGCCCGGGGGCGG + Intronic
1162965239 19:14152391-14152413 ACGGGGCTGCAGCACGGGGTTGG + Exonic
1163029824 19:14536998-14537020 GTGGGGCTTGAGGACGGGGAGGG + Intronic
1163460820 19:17436531-17436553 GCTGGCCTGGGGCACTGGGACGG - Exonic
1163557057 19:17998858-17998880 TCTGGGCTGGAGCTCAGTGAGGG + Exonic
1163829361 19:19540483-19540505 GCGGGGCTGGATGACGGGGGCGG + Intronic
1164722600 19:30443699-30443721 CCGGGGATGGAGCTCGGGGAAGG - Exonic
1164796496 19:31037746-31037768 GCTGTGCTGGAGCAGTAGGAGGG - Intergenic
1165232135 19:34393865-34393887 GCTGAGCAGCTGCACGGGGAGGG - Intronic
1165403030 19:35613797-35613819 GCTGGGCTAGAGCAGGGGAGGGG + Intronic
1165424000 19:35735797-35735819 GCTGGGCTTGAACACCTGGAAGG - Intronic
1165429795 19:35766138-35766160 GTGGGGCTGGAGCAGGGTGAGGG + Intronic
1166066554 19:40363093-40363115 TCAGGGCTGGAGAACTGGGATGG - Intronic
1166295650 19:41888047-41888069 GCAGGGCTGGAGGAAGAGGAGGG - Exonic
1166567532 19:43774362-43774384 GCTGCGCAGGAGCACGGCGCGGG + Exonic
1166937522 19:46343335-46343357 GCTGGGCTAGGGAAAGGGGAGGG + Exonic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167254653 19:48419832-48419854 GCTGGGCTGGAGCTGGGGCTGGG + Intronic
1167591973 19:50409068-50409090 GGTGGGCTGGAGCAGGAGGGTGG + Intronic
1167988843 19:53340807-53340829 GCATGGCTGGAGCAGAGGGAGGG - Intronic
1168061101 19:53892651-53892673 GCAGGGCTGGGGCCTGGGGATGG + Intronic
1168103465 19:54153164-54153186 TCTGGGCTGGAAGGCGGGGACGG - Intronic
1168304699 19:55429211-55429233 GCTGGGCTAGAGCTAGTGGAGGG + Exonic
1168649589 19:58085022-58085044 GCAGGGCTGGAGGCCGGGCAGGG - Exonic
1168675498 19:58275055-58275077 ACTGGGGTGGGGCAGGGGGAGGG + Intronic
925187821 2:1861203-1861225 GCTGAACTGGGGCATGGGGACGG + Intronic
925337559 2:3109116-3109138 GATGGCCTGGAGCATGGGCAGGG - Intergenic
925988777 2:9236953-9236975 GCAGGGCTGGGGTACGGAGACGG + Intronic
926055788 2:9773201-9773223 GCTGGGCTGGAGCCGGGGAATGG - Intergenic
926380823 2:12287576-12287598 GCTGGGGTAGAGGACTGGGAAGG + Intergenic
926684072 2:15685099-15685121 GCTGGGCTGGGACTCAGGGAGGG - Intergenic
927466802 2:23342892-23342914 GGTGGGCTGGAGAGCGAGGAAGG + Intergenic
927696931 2:25245381-25245403 GCTGGGCTCCGGCCCGGGGAGGG - Intronic
927887148 2:26725520-26725542 GCCGGCCTGGAGGACAGGGAAGG + Intronic
928249693 2:29664671-29664693 GCTGGGTTGCAGCATGAGGATGG - Intronic
929196569 2:39191106-39191128 GCTGGGCTAGAGGCCGGGCATGG + Intronic
929239588 2:39640068-39640090 GCAGGGATGGAGCAGGGGGCAGG + Intergenic
929574742 2:43044322-43044344 GCTGGTCTGGGGAGCGGGGAGGG + Intergenic
929799665 2:45088820-45088842 GCTGGGGAGGAGGACCGGGAAGG + Intergenic
930105102 2:47633124-47633146 GCAGGGCTGGAGCTTGGGGCTGG + Intergenic
931515907 2:63050638-63050660 GCGGGGCGGGAGGGCGGGGAGGG + Intronic
931604254 2:64036353-64036375 GCTGGGAAGGAGCCCAGGGAAGG - Intergenic
932432920 2:71686223-71686245 GATGGGCTGGAGCACTAGGCAGG + Intronic
932587089 2:73037064-73037086 GCTAGACTGGAGCATGGTGATGG - Intronic
932846012 2:75136563-75136585 GCTTTGCTGGAGGAGGGGGAAGG - Intronic
932858185 2:75260692-75260714 GCTGAGCTGGAGGACAGAGAAGG + Intergenic
932941891 2:76176796-76176818 GCTGGGAAGGGGCAGGGGGAGGG - Intergenic
934870171 2:97857266-97857288 ACTGGGCTGGAGCCCGGTGGGGG + Intronic
934936963 2:98472630-98472652 CCTGGGCTGGGGCTAGGGGAGGG - Intronic
935008907 2:99112696-99112718 GCATGGCTGGAGCACAGTGAGGG + Intronic
935081198 2:99796538-99796560 TCTGGGCTATAGCACAGGGAGGG + Intronic
935678527 2:105616968-105616990 GTTGGGGTGGAGCCCAGGGAGGG - Intergenic
936508163 2:113124525-113124547 GCAGGGCAGGAGCAAGGGGCTGG + Intronic
936768319 2:115880477-115880499 GCTTGGCTGGAGGAAGGTGATGG + Intergenic
937292226 2:120788606-120788628 GCTGGGCTGGAACAGGGGCCAGG - Intronic
937338836 2:121078017-121078039 GATGGGCTAGAGTGCGGGGAAGG + Intergenic
937379556 2:121364284-121364306 GAGGGGCTGGAGGAAGGGGATGG - Intronic
937764353 2:125642061-125642083 GCTGGCCTGTGGCATGGGGATGG - Intergenic
937933188 2:127221058-127221080 GGAGGGATGGAGCACGGGAAAGG + Intergenic
938296400 2:130182150-130182172 GAGGGGCGGGAGCGCGGGGACGG - Exonic
940919066 2:159287238-159287260 GCAGGGCTGGGGCCCGGGGCAGG - Intergenic
941939252 2:171016072-171016094 GGTGGGCTGGAGAGTGGGGATGG - Intronic
942191295 2:173473213-173473235 TCTGGGCTGGGGGAGGGGGAAGG - Intergenic
942202634 2:173587128-173587150 GCTGGGCTGGAGCAGTGCAATGG - Intergenic
942965469 2:181888074-181888096 GCTGGGGTGGAGGAAGAGGAGGG + Intergenic
943575646 2:189627700-189627722 AATGGGCTGGAGCTTGGGGATGG + Intergenic
944413770 2:199464251-199464273 GCTTGGCTGTAGGGCGGGGAGGG - Intronic
944448779 2:199819632-199819654 GCTGGGCTGGTTCACGAGGAGGG - Exonic
945245324 2:207711944-207711966 GCTGGGCCGGCGCGCGGGGTCGG + Exonic
946412518 2:219522400-219522422 GCTGGGCAGGTCCCCGGGGAGGG + Intronic
946416870 2:219544130-219544152 GCTGGGCCTGAGGAAGGGGAAGG - Exonic
947704783 2:232265411-232265433 GCTGGACTAGAGCTGGGGGAGGG - Intronic
947859673 2:233349563-233349585 GAAGGGCTGGAGAAGGGGGATGG + Intergenic
948900510 2:240954547-240954569 GCTGGGCTGGCTCACGGGGAGGG - Intronic
949023641 2:241754955-241754977 GCTGGGCTTGAGCCCTGGGTAGG + Intronic
1169363075 20:4968050-4968072 GGTGGGCTGGAGCAAGGAGATGG + Intronic
1171087432 20:22250616-22250638 GGAGGGCTGGAGCAGGAGGAGGG + Intergenic
1171238239 20:23545262-23545284 GATGGGGTGGAGCCTGGGGAGGG - Intergenic
1171346763 20:24471058-24471080 GCTGGGCTGTAGGAGGGAGACGG - Intronic
1171780237 20:29410938-29410960 GCTGGGCTGGAGCAGGGGGACGG + Intergenic
1171798073 20:29581858-29581880 GTTGGGCTGGAACAAGGGGTAGG + Intergenic
1171813108 20:29761761-29761783 GCTGGGCTGGAGCGGGGGAACGG - Intergenic
1171824201 20:29879202-29879224 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1171850170 20:30302303-30302325 GTTGGGCTGGAACAAGGGGTAGG - Intergenic
1171906127 20:30900555-30900577 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1171982088 20:31635387-31635409 GGTGGGCTGGACCACCGAGAAGG - Intergenic
1172122542 20:32607459-32607481 GCTGGGCCTGAGCAGAGGGACGG - Intronic
1172199302 20:33114028-33114050 GGTGGGCTGGGGAATGGGGATGG - Intergenic
1172841094 20:37903175-37903197 GCTGGGCCGGAGCCGGGCGAGGG + Exonic
1172845425 20:37927505-37927527 GGTGGGCAGGAGCACAGGGGAGG - Intronic
1173659657 20:44724605-44724627 CCTGGGCTGGAGCCCTGGGCAGG + Intronic
1174053955 20:47785559-47785581 GCTGGGGCGGCGCGCGGGGAGGG - Intronic
1174498501 20:50966634-50966656 GTTGGGCTTGAGCACCTGGATGG + Intergenic
1174524945 20:51163270-51163292 GGTGGGCTGGAGCCAGGTGATGG + Intergenic
1175924854 20:62466593-62466615 GCGCGGCTGGAGCAGGGGGACGG + Intronic
1176015535 20:62929325-62929347 GCGGGGGAGGGGCACGGGGAGGG + Intronic
1176128225 20:63485412-63485434 GGTGGGGAGGAGCACAGGGAGGG - Intergenic
1176218277 20:63958297-63958319 GCTGGGCTGGACCAGGGCGTGGG - Exonic
1176223438 20:63980786-63980808 GCTGGGCTGGTTCAGAGGGAGGG + Intronic
1176369284 21:6052738-6052760 GCTGGGCAAGAGCAGGGGGGCGG + Intergenic
1176722303 21:10402536-10402558 GCTGGGCAGGAGCATGAGCAAGG - Intergenic
1177594617 21:23221908-23221930 TCTTGGCTGTAGCACAGGGAAGG - Intergenic
1178327906 21:31660082-31660104 GCGTGGCGGGAGCGCGGGGAGGG + Intronic
1178599620 21:33984554-33984576 GCTGTGCTGGAGCACTGGCCGGG + Intergenic
1179051142 21:37889449-37889471 GCTGGGCTGGGGAAAGGGGTGGG + Intronic
1179098009 21:38332881-38332903 GTTGGGGTGGAGCCAGGGGAGGG - Intergenic
1179129177 21:38619154-38619176 GACTGGCTGGAGCATGGGGAAGG - Intronic
1179601955 21:42485222-42485244 GCTGGCCTGTAGCATGAGGAGGG + Intronic
1179754235 21:43485803-43485825 GCTGGGCAAGAGCAGGGGGGCGG - Intergenic
1180161550 21:46000614-46000636 GCGGGGCAGGAGGCCGGGGAAGG + Intronic
1180303487 22:11055298-11055320 GCTGGGCAGGAGCATGAGCAAGG - Intergenic
1180315786 22:11276801-11276823 GCTAGGCTGGAGCGGTGGGACGG - Intergenic
1180339552 22:11606674-11606696 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG + Intergenic
1180834622 22:18923649-18923671 GCTGGCCTGGAGGACAGGGTGGG - Intronic
1181114260 22:20621290-20621312 CCTGGGCTGGAGGACAGTGAGGG + Intergenic
1181354465 22:22289935-22289957 GCAGGGCAGGACCAAGGGGAAGG + Intergenic
1181532121 22:23522733-23522755 GCCGGGCTGGGGCGCGGGCAGGG + Intergenic
1181711751 22:24695742-24695764 GCCGGCCTGGAGGACGGGGTGGG - Intergenic
1182278976 22:29207191-29207213 GCAGGGCTGGAGGACGGAGGTGG + Intronic
1182438336 22:30345831-30345853 GCTGGGCCTCAGCACAGGGAAGG + Intronic
1182569145 22:31223123-31223145 GCTGGGGTGAAGGACAGGGAAGG + Intronic
1182629847 22:31676801-31676823 GCCGGGCTGGAGAGCGGGGAGGG - Intronic
1182735157 22:32528223-32528245 GCTGGGAAGGGGCACGGGGCAGG - Intronic
1183368692 22:37420248-37420270 GCTGGGCCGGAGGAGGGGGCGGG - Intronic
1183410976 22:37655045-37655067 GCTGGGGTGGGGCATGGGGTGGG + Intronic
1183691882 22:39394827-39394849 GCGTGGCTGAAGCACGGGGGAGG - Intergenic
1184409172 22:44316786-44316808 CCTGGGCTGGAGCATGTGGCAGG + Intergenic
1184428610 22:44428086-44428108 GCTGTGCTGGAGCACTGGGCTGG + Intergenic
1184455415 22:44607236-44607258 GCAGGGGTGGAGCAGAGGGATGG + Intergenic
1184647306 22:45903330-45903352 GCTGGGATGGGGCACCAGGAGGG - Intergenic
1184880407 22:47300824-47300846 GCTGGGCTGGGGCAGGTGGCAGG - Intergenic
1185038126 22:48490102-48490124 CCCGGGCTGAGGCACGGGGAGGG - Intronic
1185161479 22:49232520-49232542 GCAGGGCTGGAGCATGAGGTAGG - Intergenic
1185245584 22:49771246-49771268 GCTCGGCTTGAGCGTGGGGAGGG - Intergenic
1185294558 22:50046787-50046809 GCAGGGCTGGAGGCCGGGGGAGG + Intronic
1185366197 22:50438043-50438065 GCTGGAGGGGAGGACGGGGAGGG - Intronic
1185385264 22:50528964-50528986 GCTGTGCTGGGGAACGGGGTGGG + Intronic
1203284711 22_KI270734v1_random:148948-148970 GCTGGCCTGGAGGACAGGGTGGG - Intergenic
950518152 3:13480505-13480527 GCTGGCCTGGCGCGCCGGGAGGG - Intronic
950833057 3:15894021-15894043 GCTGTGCTGGAACTGGGGGAAGG + Intergenic
951464176 3:22984239-22984261 GGTTGGCTGGGGCATGGGGATGG + Intergenic
953099331 3:39809732-39809754 GCTGGGCTGCAGCACCGCGGGGG - Exonic
953725461 3:45394102-45394124 CCTGGGCTGGCCCATGGGGAGGG + Intronic
954370000 3:50165205-50165227 GAAGAGCTGGAGCACAGGGAGGG + Intronic
955964177 3:64370980-64371002 GATGGGATGGAACATGGGGAGGG + Intronic
956407191 3:68940245-68940267 GCTGAGTTGGTGAACGGGGAAGG - Intergenic
957084859 3:75669571-75669593 GCTGGGCTGGAGCACGGGGACGG - Intergenic
961005020 3:123399048-123399070 GCGGGGCTGAAGCTTGGGGAGGG - Intronic
961382257 3:126503520-126503542 TCTGCCCTGGAGCACAGGGAGGG + Intronic
961550412 3:127667752-127667774 GCTGGGCTGGAACAGAGGGAGGG - Intronic
961641724 3:128368901-128368923 GCTGGGCTGTAGCACAGCCACGG + Intronic
961831186 3:129623740-129623762 GCTGGGCTGGGGCTCCGGGCTGG + Intergenic
962942148 3:140134740-140134762 GCTGGGCTGGGGGAAGGAGAGGG + Intronic
963601811 3:147385193-147385215 GCTTGGTTGGAGCAAGGGGCTGG - Intergenic
963974072 3:151461032-151461054 GCTGGTCCGGAGCTCTGGGAGGG + Intergenic
965728617 3:171746165-171746187 GCTGTGCGGGAGCCCGCGGAGGG - Intronic
967134696 3:186503556-186503578 GCTGGGCTGCAGCCCCAGGAGGG - Intergenic
967900362 3:194444131-194444153 GCTGGGCCGTAGCATGGGCACGG - Intronic
968434381 4:576908-576930 GGTGGGAAGGAGCCCGGGGAGGG + Intergenic
968434409 4:576958-576980 GGTGGGAAGGAGCCCGGGGAGGG + Intergenic
968468693 4:766310-766332 GCAAGGCTGAAGCACGGGGTGGG - Exonic
968479792 4:828023-828045 CCTGGGTTGTAGAACGGGGAGGG - Intergenic
968531382 4:1093778-1093800 GCTGGGATGGAGCAGGGTGAGGG + Intronic
968538209 4:1148476-1148498 CCTGTGCTGGGGGACGGGGATGG - Intergenic
968614686 4:1572099-1572121 GCTGGGATGGGGGACGGGGCTGG - Intergenic
968649287 4:1754049-1754071 CCTGGGGAGGAGCACGGGGCTGG - Intergenic
968911634 4:3479482-3479504 GCTGGGCTGGAGTCGTGGGAAGG + Intronic
969417844 4:7072712-7072734 GCTGGCCTGAAGGACAGGGAAGG + Intergenic
969629549 4:8328459-8328481 CCTGGGCTGGAGCGAGGGGTGGG - Intergenic
969697350 4:8742172-8742194 GCTGGGGTGGGTCACTGGGAGGG - Intergenic
969973143 4:11068954-11068976 GCTGGCCTTGAGGAAGGGGAAGG + Intergenic
970407695 4:15778954-15778976 GGTGGGCTGCAGCCCGGCGAGGG - Intronic
973259526 4:48148077-48148099 GCTGGGCTGGTGAAGGGGGATGG + Intronic
976921902 4:90452569-90452591 GCTGGGCTGGACCTCGGGCCTGG + Intronic
978602573 4:110444055-110444077 GCATGGCTGGAGCAGGAGGAAGG - Intronic
980713473 4:136600820-136600842 GCTGGACTGGAGTGCAGGGAAGG - Intergenic
980973938 4:139592814-139592836 GCTGGGCTGGAGCAGGAGTGTGG + Intronic
982653895 4:158121920-158121942 GGTGGTCTGGAGCTAGGGGAGGG - Intergenic
984257544 4:177406620-177406642 ACTGGGGTGGAGCAGGGGGGCGG - Intergenic
984640649 4:182160675-182160697 GCTGGGATGGGACATGGGGAAGG + Intronic
984945171 4:184965252-184965274 GCCGGGATGGAGCGCCGGGATGG + Intergenic
984945201 4:184965367-184965389 GCCGGGATGGAGCGCCGGGATGG + Intergenic
985284612 4:188322710-188322732 ACTCGGTTGGAGCTCGGGGAAGG + Intergenic
985446111 4:190022003-190022025 GCTGGGCTGCAGCGCGGGGGCGG + Intergenic
985451271 4:190065280-190065302 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
985452262 4:190068575-190068597 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
985453246 4:190071872-190071894 GCTGGGCTGCAGCGCGGGGGCGG - Exonic
985454236 4:190075165-190075187 GCTGGGCTGCAGCGCGGGGGCGG - Exonic
985455224 4:190078458-190078480 GCTGGGCTGCAGCGCGGGGGCGG - Exonic
985456212 4:190081758-190081780 GCTGGGCTGCAGCGCGGGGGCGG - Exonic
985457196 4:190085052-190085074 GCTGGGCTGCAGCGCGGGGGCGG - Intergenic
985458183 4:190088345-190088367 GCTGGGCTGCAGCGCGGGGGCGG - Exonic
985459172 4:190091645-190091667 GCTGGGCTGCAGCGCGGGGGCGG - Exonic
985463425 4:190174414-190174436 GCTGGGCTGCAGCGCGGGGGCGG - Exonic
985780698 5:1869399-1869421 CCTGGGCAGGAGCAGGGGGCAGG + Intergenic
985956244 5:3268262-3268284 GCAGGGCTGGAGAGAGGGGAAGG - Intergenic
986590583 5:9365222-9365244 CCAGGGCTGGAGCAAGGGCAAGG + Intronic
987430899 5:17831803-17831825 GGGGGTCTGGAGCAAGGGGAGGG - Intergenic
989193142 5:38690679-38690701 GCATGGCTGGAGCAGGAGGAAGG + Intergenic
989470626 5:41813497-41813519 TCTAGGCTGGAGCTAGGGGATGG - Intronic
993095404 5:83473585-83473607 GCTGCCTTGGAGCACGGGAAAGG - Intronic
996843646 5:127875933-127875955 GCTGGGTGGTAGCAGGGGGAGGG + Intergenic
997419737 5:133756543-133756565 GGTGGGCTGGAACTGGGGGAAGG - Intergenic
997642382 5:135457742-135457764 GCTGCGCTGGAGGAGGGAGAGGG + Intergenic
997854832 5:137364021-137364043 GCTGGGCTGGGGCAGGTGCAGGG - Intronic
997955607 5:138276234-138276256 CTTGGGCTGGAGGAGGGGGAGGG - Intergenic
998041160 5:138951757-138951779 GCTGGGCAGGAGGAAGGGCATGG + Intronic
998333741 5:141352062-141352084 GCTGGCCTGCAGCACGTGGTAGG - Exonic
998334814 5:141361949-141361971 GCTGGCCTGCAGCACGTGGTAGG - Exonic
998343731 5:141441932-141441954 GCTGGCCTGCAGCACGTGGTAGG - Intronic
999011947 5:148052190-148052212 GCCAGGCTGTAGCACGGAGAGGG - Intronic
999126578 5:149250513-149250535 GCTGTGCTGGAGGATGGGGGAGG + Intronic
1000334071 5:160228994-160229016 GCTGACCTGGAGCATGGGGAAGG - Intronic
1001382491 5:171313619-171313641 GCAGGGCTGGAGGAAGGGGAGGG + Intergenic
1002093556 5:176818076-176818098 GCTGGGCTACAGCACGGAGGCGG - Intronic
1002434369 5:179221864-179221886 GGGGGGCTGGAGCAGAGGGAAGG - Intronic
1003006989 6:2391567-2391589 GATGGGCTGGAGCCGGGGCAGGG + Intergenic
1003007680 6:2397063-2397085 GCTGGGCTGCTGAACAGGGAGGG - Intergenic
1003086324 6:3064081-3064103 GCCGGGGTGGAGCACGGGAGTGG + Intronic
1004235251 6:13869713-13869735 CCTGGGCTGGGGTATGGGGATGG - Intergenic
1004736450 6:18410786-18410808 GCAAGGCTGGAGCAGGAGGAGGG + Intronic
1006101409 6:31688396-31688418 GCTGTGCTATAGCAAGGGGAGGG - Intronic
1006373240 6:33658068-33658090 GCTGGGCTGGTGCTGGGTGAGGG + Intronic
1006398393 6:33801793-33801815 GATGCACTGGAGCACGGGGCGGG - Intronic
1006503046 6:34470048-34470070 GCTGGGCTGGAGACTGGGGTCGG + Intronic
1006641547 6:35492049-35492071 GCAGGGCTGGTGCAGGGGAAGGG - Intronic
1006911381 6:37565853-37565875 GCTGAGCTGGAGCTGAGGGAGGG + Intergenic
1007432767 6:41786297-41786319 GCTGGGCCGGGGCACTGGAAGGG + Exonic
1007585735 6:42988127-42988149 TGTGGGCTGGAGTAGGGGGAAGG - Intronic
1007695938 6:43734323-43734345 GATGGGCTGGGGCAGGGGGAGGG - Intergenic
1007759890 6:44127608-44127630 GCGGGGCTGGGGGAGGGGGAGGG - Intronic
1010191413 6:73201028-73201050 CCTGAGCTGCAGCAAGGGGAGGG - Intergenic
1011418949 6:87152201-87152223 CCTGGGCCGGAGAACGGAGAAGG - Intergenic
1012352181 6:98265959-98265981 GCTGGGCAGGAGCAGGGGCCAGG + Intergenic
1016036474 6:139388642-139388664 GCTGGGGTGGGGCTGGGGGAGGG - Intergenic
1016386713 6:143536956-143536978 GCGGGGCCGGAGCACCGGGTGGG - Intronic
1016827841 6:148404746-148404768 GCTGGGGTGGGGCACGGGCTGGG - Intronic
1016881850 6:148919320-148919342 GCTGGGCTGGAGCAGGTAGTGGG - Intronic
1016917735 6:149260333-149260355 GCTGCGCTGGAGCACGCGGTGGG - Intronic
1017670754 6:156767203-156767225 GGTGGGCTGAAGCAGGAGGAGGG - Intergenic
1018161924 6:161053195-161053217 TCATGGCTGGAGCACGGGCAGGG + Intronic
1018196016 6:161356597-161356619 GCTGGATCAGAGCACGGGGAAGG + Intronic
1018640332 6:165898802-165898824 GCTGGGATGGAGCAGGGAGGAGG - Intronic
1018719070 6:166558567-166558589 GCTGGGCTGGGGCAGGGGGAGGG + Intronic
1019148910 6:169991313-169991335 GCTGGGGTAGAGCACAGAGAGGG + Intergenic
1019299495 7:296211-296233 GCTGGGCAGGACCTGGGGGAGGG - Intergenic
1019343177 7:518054-518076 GCTGGGCCGGAGCCCGGGGTGGG - Intronic
1019515634 7:1438684-1438706 GCGGGCCTGGGGCACGGGGCTGG + Intronic
1019711427 7:2519813-2519835 GCAAGGCAGGCGCACGGGGAAGG + Intronic
1020276615 7:6628467-6628489 GGTGGGCTGGAGCACCAGAAAGG + Intergenic
1020278144 7:6637038-6637060 GCCGGGCTGGGGTTCGGGGAAGG + Intergenic
1021553840 7:21899831-21899853 GCTGCGCTGGAGCAGGGGGTTGG - Intronic
1022225770 7:28361466-28361488 GCTGGGCTGGGGCAGGGAAAAGG - Intronic
1022502079 7:30887929-30887951 GAATGGCTGGAGCACGGGAACGG + Intronic
1023013610 7:35944187-35944209 GCTGAGGTGGGGCAGGGGGAGGG + Intergenic
1023015626 7:35967424-35967446 GCGGGCCCGGAGCAGGGGGAAGG + Intergenic
1023098236 7:36685380-36685402 GATGGGATGGAGCATGTGGATGG + Intronic
1023901991 7:44488736-44488758 GCAGGGATGGAGGAAGGGGAGGG - Intronic
1023940366 7:44765460-44765482 GCTGGGCATGAGCACGTGGGCGG - Exonic
1023965849 7:44962745-44962767 GCTGGGCCAGAGCAGGGTGAAGG + Exonic
1024045094 7:45580445-45580467 GCCAGGCTTGAGCACGGGGCTGG + Intronic
1024077519 7:45829647-45829669 GCTGAGGTGGGGCAGGGGGAGGG - Intergenic
1025126894 7:56351765-56351787 GCTGAGGTGGGGCAGGGGGAGGG + Intergenic
1025622486 7:63186528-63186550 GCATGGCTGGAGCAGGAGGAAGG - Intergenic
1026350517 7:69511397-69511419 GCTGGGCAGGAGGATGGGGATGG - Intergenic
1026949349 7:74337229-74337251 GCTGGGCTGCAGCTTGGGGAGGG + Intronic
1027735312 7:81925273-81925295 GCTGAACTCTAGCACGGGGACGG - Intergenic
1029378811 7:100199313-100199335 GCTCGGCTGAAGGACTGGGAGGG + Exonic
1029419893 7:100467059-100467081 GCTGCGCTGGAGCAGGAGAATGG - Exonic
1029551667 7:101239956-101239978 GCAGGGCTGGCGGAAGGGGACGG - Intronic
1029592683 7:101517723-101517745 GCTGGGCTGGAAGACAGGGTTGG + Intronic
1029642137 7:101827915-101827937 GAAGGGCTGGAGCAGGTGGAGGG + Intronic
1030249589 7:107427702-107427724 GCTGAGCTGGTGCACGAGCAAGG - Intronic
1030532388 7:110727513-110727535 ACTGGTTTGGAGCACTGGGAGGG - Intronic
1031288307 7:119900460-119900482 GCTGTGCTGGAGCAAGGGCCTGG + Intergenic
1032062343 7:128735625-128735647 GCATGGCTGGAGCAGGAGGAAGG + Intergenic
1032481527 7:132250976-132250998 GCTGGGCTTGGGGATGGGGAGGG - Intronic
1032743282 7:134761227-134761249 ACTGGGTTGGAGCAGGGGGTTGG - Intronic
1033210660 7:139457734-139457756 GCGGGGCTGGGGCTCGGGGGAGG - Intronic
1033647107 7:143313961-143313983 GCTGGGCTGGAGTAGGGGGTGGG - Intergenic
1034553814 7:151837405-151837427 GCAGTGCTGGCCCACGGGGATGG + Intronic
1035050787 7:155998087-155998109 GCTGTGCAGGAGCCCGTGGACGG + Intergenic
1035168057 7:157003249-157003271 GCTCTGCTGGAGGACGGGGGAGG + Intronic
1035325283 7:158061987-158062009 GCTGGGCATGAGCACGGCCATGG + Intronic
1035357133 7:158282939-158282961 GCTGCGTGGGAGCACGAGGAGGG - Intronic
1035637353 8:1156611-1156633 GCTGGGCTGGGGCGCTGGGCTGG - Intergenic
1036772443 8:11588424-11588446 GCTGGGGTAGAGCACTGGGGCGG + Intergenic
1036910682 8:12755093-12755115 GCTGGGCTGGAGCGCGGCCCCGG - Exonic
1037817292 8:22118908-22118930 GCTGGGCGGGGGGAAGGGGAGGG + Intronic
1037916693 8:22777399-22777421 CCTGGGCTGGAGCCCAGGGTGGG + Intronic
1038761202 8:30385043-30385065 GCAGGGCTGGGGCGCGGGGCTGG - Exonic
1039568093 8:38565277-38565299 GATGGGTGGGAGCACAGGGAAGG - Intergenic
1040481429 8:47831306-47831328 GCTGAACTGGAGCACCGCGAGGG + Intronic
1040500037 8:47997736-47997758 GCTGGGCTCGAGGACGAGTAAGG + Intergenic
1046061904 8:109150355-109150377 GTTGGGCTAAAGAACGGGGAAGG + Intergenic
1046670746 8:117053529-117053551 GCTGGGCTGGGGCTCGGGCTCGG - Intronic
1048277438 8:133077549-133077571 GCTGTGCCAGAGCAGGGGGATGG + Intronic
1048477472 8:134756473-134756495 ACCGTGCTGGAGAACGGGGAGGG - Intergenic
1048847677 8:138615954-138615976 GCTGGGCTGGGGCTGGGGGTGGG - Intronic
1049521319 8:143092836-143092858 GCTGGGCAGGAGCCCGTGGAGGG - Intergenic
1049580491 8:143408508-143408530 GCTGGGATGGAGACCGGGGCTGG + Intergenic
1049673654 8:143880350-143880372 GCTGGGCTGAAGCACTGGACTGG - Intergenic
1049955294 9:687576-687598 GCTGGGCAACAGCACTGGGAGGG - Intronic
1050324949 9:4490099-4490121 GCTGGTGTGGAGAACGGAGAGGG + Intergenic
1052495081 9:29214245-29214267 GCTCAGCTGGAGAAAGGGGAGGG + Intergenic
1053180274 9:35962408-35962430 GCTGGGCTGGGGCGGGGGCAGGG - Intergenic
1053221703 9:36318072-36318094 GCTGCCCTGGAGCTCCGGGAAGG + Intergenic
1055628333 9:78197032-78197054 GGTGGGCTGGAGCTAGGGGTTGG - Intergenic
1056688368 9:88785138-88785160 GCAGGGCTGGTGGATGGGGAGGG - Intergenic
1056852077 9:90093279-90093301 GCAGGGCTGGGGTAGGGGGAGGG + Intergenic
1057274754 9:93670368-93670390 GCTGGGCTGGACCACGTGAGTGG + Intronic
1057837173 9:98454781-98454803 GCTGGGCTGCAGGATGGAGAGGG - Intronic
1059841510 9:118222681-118222703 GCTGGGCTGGAGCATGAAGCTGG - Intergenic
1060300260 9:122370971-122370993 GCGGGGGTGGAGCCGGGGGAAGG + Intronic
1060407544 9:123380358-123380380 GCTGGCCTGGAGCTCTGGGCAGG + Exonic
1060427643 9:123519766-123519788 GATGGGCTGGAGCAGAGGCATGG + Intronic
1060530305 9:124343818-124343840 GCTGTGCTGGGGCTTGGGGAAGG - Intronic
1061281163 9:129598196-129598218 GCTTGGATGGGGCACGCGGACGG - Intergenic
1061621910 9:131816094-131816116 GATGGGAATGAGCACGGGGATGG + Intergenic
1062028639 9:134352114-134352136 GCTGGGGTGCAGCAAGGGGAGGG + Intronic
1062040417 9:134401889-134401911 GCGGGGCTGGGGCAAGGGGAGGG + Intronic
1062288328 9:135783555-135783577 GCAAGCCTGGAGCACAGGGACGG + Intronic
1062327698 9:136019992-136020014 GCTGGGTGGGGGAACGGGGAGGG + Intronic
1062346823 9:136118813-136118835 GCGGGCCCGGAGCAGGGGGAAGG - Exonic
1062394710 9:136348141-136348163 GATGGACAGGAGCCCGGGGAAGG + Intronic
1062412988 9:136434120-136434142 GCTGGGCGGGAGCTCCTGGAAGG + Exonic
1062453993 9:136627191-136627213 GCCCAGCTGGAGCACGGGGAGGG + Intergenic
1062560763 9:137140913-137140935 CCTGGGCTGGGGCACGGGGGTGG - Intronic
1062610951 9:137373201-137373223 GCAGGGCTGGGGCACGGGAGGGG + Intronic
1062708062 9:137956126-137956148 GCTGGCCTGGGGCGAGGGGAGGG - Intronic
1203736548 Un_GL000216v2:143857-143879 GCTGGGCTGGAGCACAGGGACGG - Intergenic
1203740060 Un_GL000216v2:171103-171125 GCTGGGCTGGAGCACGGGGACGG - Intergenic
1203364079 Un_KI270442v1:242756-242778 GCTAGGCTGGAGCGGTGGGACGG - Intergenic
1203377274 Un_KI270442v1:385647-385669 GCTGGGCTGGAGCAGGGGGATGG + Intergenic
1185644760 X:1608905-1608927 GCTTGGCTGGAGTAGGGGCAGGG - Intergenic
1185645050 X:1610073-1610095 GCTTGGCTGGAACAGGGGCAGGG - Intergenic
1186410597 X:9342275-9342297 GGTGGGAAGGAGCAGGGGGAGGG - Intergenic
1189446389 X:41085254-41085276 GCTGGGCAGGAGCAGGGGGAGGG + Intergenic
1191755822 X:64591291-64591313 GTTGGGTTGGAGCAAGTGGATGG + Intergenic
1192227801 X:69241393-69241415 GTAGGGCTGGGGCAGGGGGAGGG - Intergenic
1192478422 X:71464073-71464095 CCTAGGCTGGAGAACAGGGAAGG - Exonic
1192486817 X:71534219-71534241 ACTGGGCTGAAGAATGGGGATGG - Intronic
1194664209 X:96659524-96659546 GCTGGGCTTTATCACTGGGATGG + Intergenic
1195851350 X:109285270-109285292 TCTGGGATGGAGCACTGGTAAGG - Intergenic
1196829268 X:119763505-119763527 GCTGTGATGGATCAGGGGGAGGG + Intergenic
1197345578 X:125322967-125322989 ACTGGGCTGGAGCATGAGGCAGG - Intergenic
1198214892 X:134546471-134546493 GCAGGGCTGTAGTCCGGGGAGGG - Intergenic
1199649613 X:149939235-149939257 GGGGGGCTGGGGCTCGGGGAGGG + Intergenic
1201175741 Y:11307557-11307579 GCTGGGCTGGAGCACGGGGATGG - Intergenic
1201177003 Y:11315561-11315583 GCTGGGCTGCAGTACAGGGGCGG - Intergenic
1201179707 Y:11332971-11332993 GCTGGGCTGGAGCACGGGGACGG - Intergenic