ID: 1202858200

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:64294-64316
Sequence CGGGGACGGCCCTCACTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202858197_1202858200 -5 Left 1202858197 14_GL000225v1_random:64276-64298 CCTTGCTGGGCTGGAGCACGGGG No data
Right 1202858200 14_GL000225v1_random:64294-64316 CGGGGACGGCCCTCACTCCCTGG No data
1202858190_1202858200 10 Left 1202858190 14_GL000225v1_random:64261-64283 CCTGTGCCGGGGCAGCCTTGCTG No data
Right 1202858200 14_GL000225v1_random:64294-64316 CGGGGACGGCCCTCACTCCCTGG No data
1202858189_1202858200 11 Left 1202858189 14_GL000225v1_random:64260-64282 CCCTGTGCCGGGGCAGCCTTGCT No data
Right 1202858200 14_GL000225v1_random:64294-64316 CGGGGACGGCCCTCACTCCCTGG No data
1202858193_1202858200 4 Left 1202858193 14_GL000225v1_random:64267-64289 CCGGGGCAGCCTTGCTGGGCTGG No data
Right 1202858200 14_GL000225v1_random:64294-64316 CGGGGACGGCCCTCACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202858200 Original CRISPR CGGGGACGGCCCTCACTCCC TGG Intergenic
No off target data available for this crispr