ID: 1202858939

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:69189-69211
Sequence TTTGTCAAGGATATGGTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202858935_1202858939 -7 Left 1202858935 14_GL000225v1_random:69173-69195 CCCAGGTGATGTCACTTTTGTCA No data
Right 1202858939 14_GL000225v1_random:69189-69211 TTTGTCAAGGATATGGTTATAGG No data
1202858934_1202858939 5 Left 1202858934 14_GL000225v1_random:69161-69183 CCGCACTGATCACCCAGGTGATG No data
Right 1202858939 14_GL000225v1_random:69189-69211 TTTGTCAAGGATATGGTTATAGG No data
1202858936_1202858939 -8 Left 1202858936 14_GL000225v1_random:69174-69196 CCAGGTGATGTCACTTTTGTCAA No data
Right 1202858939 14_GL000225v1_random:69189-69211 TTTGTCAAGGATATGGTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202858939 Original CRISPR TTTGTCAAGGATATGGTTAT AGG Intergenic
No off target data available for this crispr