ID: 1202859202

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:71420-71442
Sequence GGAGCTCCATGGTGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202859193_1202859202 21 Left 1202859193 14_GL000225v1_random:71376-71398 CCGGAGGCCGGCAGAGACAGCTA No data
Right 1202859202 14_GL000225v1_random:71420-71442 GGAGCTCCATGGTGGCAGCTGGG No data
1202859195_1202859202 14 Left 1202859195 14_GL000225v1_random:71383-71405 CCGGCAGAGACAGCTAGAGGTCT No data
Right 1202859202 14_GL000225v1_random:71420-71442 GGAGCTCCATGGTGGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202859202 Original CRISPR GGAGCTCCATGGTGGCAGCT GGG Intergenic
No off target data available for this crispr