ID: 1202859495

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:72535-72557
Sequence TGTTGGGGGATCCCCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202859481_1202859495 29 Left 1202859481 14_GL000225v1_random:72483-72505 CCTTCCGGAGGAGCCGGGGTGAC No data
Right 1202859495 14_GL000225v1_random:72535-72557 TGTTGGGGGATCCCCTCTGCTGG No data
1202859490_1202859495 -7 Left 1202859490 14_GL000225v1_random:72519-72541 CCGTGTACCGGGACAGTGTTGGG No data
Right 1202859495 14_GL000225v1_random:72535-72557 TGTTGGGGGATCCCCTCTGCTGG No data
1202859488_1202859495 -6 Left 1202859488 14_GL000225v1_random:72518-72540 CCCGTGTACCGGGACAGTGTTGG No data
Right 1202859495 14_GL000225v1_random:72535-72557 TGTTGGGGGATCCCCTCTGCTGG No data
1202859487_1202859495 -5 Left 1202859487 14_GL000225v1_random:72517-72539 CCCCGTGTACCGGGACAGTGTTG No data
Right 1202859495 14_GL000225v1_random:72535-72557 TGTTGGGGGATCCCCTCTGCTGG No data
1202859482_1202859495 25 Left 1202859482 14_GL000225v1_random:72487-72509 CCGGAGGAGCCGGGGTGACATAG No data
Right 1202859495 14_GL000225v1_random:72535-72557 TGTTGGGGGATCCCCTCTGCTGG No data
1202859480_1202859495 30 Left 1202859480 14_GL000225v1_random:72482-72504 CCCTTCCGGAGGAGCCGGGGTGA No data
Right 1202859495 14_GL000225v1_random:72535-72557 TGTTGGGGGATCCCCTCTGCTGG No data
1202859484_1202859495 16 Left 1202859484 14_GL000225v1_random:72496-72518 CCGGGGTGACATAGGCAAAATCC No data
Right 1202859495 14_GL000225v1_random:72535-72557 TGTTGGGGGATCCCCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202859495 Original CRISPR TGTTGGGGGATCCCCTCTGC TGG Intergenic
No off target data available for this crispr