ID: 1202859504

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:72563-72585
Sequence CCCTGTGCTCCAGCCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202859504_1202859513 27 Left 1202859504 14_GL000225v1_random:72563-72585 CCTTGCTGGGCTGGAGCACAGGG No data
Right 1202859513 14_GL000225v1_random:72613-72635 GCCCCCTGTGGGAGAGCACCAGG No data
1202859504_1202859512 16 Left 1202859504 14_GL000225v1_random:72563-72585 CCTTGCTGGGCTGGAGCACAGGG No data
Right 1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG No data
1202859504_1202859511 15 Left 1202859504 14_GL000225v1_random:72563-72585 CCTTGCTGGGCTGGAGCACAGGG No data
Right 1202859511 14_GL000225v1_random:72601-72623 TAGCTCACGAAAGCCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202859504 Original CRISPR CCCTGTGCTCCAGCCCAGCA AGG (reversed) Intergenic
No off target data available for this crispr