ID: 1202859506

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:72587-72609
Sequence CGTGAGCTAGGGAGCGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202859506_1202859524 27 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859524 14_GL000225v1_random:72637-72659 GCGCAGGGCACATGGGTTGCGGG No data
1202859506_1202859521 20 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859521 14_GL000225v1_random:72630-72652 ACCAGGTGCGCAGGGCACATGGG No data
1202859506_1202859523 26 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859523 14_GL000225v1_random:72636-72658 TGCGCAGGGCACATGGGTTGCGG No data
1202859506_1202859513 3 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859513 14_GL000225v1_random:72613-72635 GCCCCCTGTGGGAGAGCACCAGG No data
1202859506_1202859511 -9 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859511 14_GL000225v1_random:72601-72623 TAGCTCACGAAAGCCCCCTGTGG No data
1202859506_1202859512 -8 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG No data
1202859506_1202859518 11 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859518 14_GL000225v1_random:72621-72643 TGGGAGAGCACCAGGTGCGCAGG No data
1202859506_1202859519 12 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859519 14_GL000225v1_random:72622-72644 GGGAGAGCACCAGGTGCGCAGGG No data
1202859506_1202859520 19 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859520 14_GL000225v1_random:72629-72651 CACCAGGTGCGCAGGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202859506 Original CRISPR CGTGAGCTAGGGAGCGAGGG CGG (reversed) Intergenic
No off target data available for this crispr