ID: 1202859512

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:72602-72624
Sequence AGCTCACGAAAGCCCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202859506_1202859512 -8 Left 1202859506 14_GL000225v1_random:72587-72609 CCGCCCTCGCTCCCTAGCTCACG No data
Right 1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG No data
1202859504_1202859512 16 Left 1202859504 14_GL000225v1_random:72563-72585 CCTTGCTGGGCTGGAGCACAGGG No data
Right 1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202859512 Original CRISPR AGCTCACGAAAGCCCCCTGT GGG Intergenic
No off target data available for this crispr