ID: 1202860687

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:79433-79455
Sequence GGCCCACGAAAGCCCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202860674_1202860687 25 Left 1202860674 14_GL000225v1_random:79385-79407 CCGGCGCGGCCTGGCTGGGCTGG No data
Right 1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG No data
1202860678_1202860687 16 Left 1202860678 14_GL000225v1_random:79394-79416 CCTGGCTGGGCTGGAGCTCGGGG No data
Right 1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202860687 Original CRISPR GGCCCACGAAAGCCCCCTGA GGG Intergenic
No off target data available for this crispr