ID: 1202860824

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:80006-80028
Sequence CCCCGCAGAAGCCCGGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202860824_1202860838 15 Left 1202860824 14_GL000225v1_random:80006-80028 CCCGTCCCCGGGCTTCTGCGGGG No data
Right 1202860838 14_GL000225v1_random:80044-80066 GGTGTCGGGAGGGCCATCGCGGG 0: 6
1: 8
2: 4
3: 11
4: 88
1202860824_1202860832 -6 Left 1202860824 14_GL000225v1_random:80006-80028 CCCGTCCCCGGGCTTCTGCGGGG No data
Right 1202860832 14_GL000225v1_random:80023-80045 GCGGGGAGGGTGCTTTCTGAAGG No data
1202860824_1202860833 0 Left 1202860824 14_GL000225v1_random:80006-80028 CCCGTCCCCGGGCTTCTGCGGGG No data
Right 1202860833 14_GL000225v1_random:80029-80051 AGGGTGCTTTCTGAAGGTGTCGG No data
1202860824_1202860841 28 Left 1202860824 14_GL000225v1_random:80006-80028 CCCGTCCCCGGGCTTCTGCGGGG No data
Right 1202860841 14_GL000225v1_random:80057-80079 CCATCGCGGGGAGCCCCAGCCGG No data
1202860824_1202860834 1 Left 1202860824 14_GL000225v1_random:80006-80028 CCCGTCCCCGGGCTTCTGCGGGG No data
Right 1202860834 14_GL000225v1_random:80030-80052 GGGTGCTTTCTGAAGGTGTCGGG No data
1202860824_1202860837 14 Left 1202860824 14_GL000225v1_random:80006-80028 CCCGTCCCCGGGCTTCTGCGGGG No data
Right 1202860837 14_GL000225v1_random:80043-80065 AGGTGTCGGGAGGGCCATCGCGG 0: 20
1: 14
2: 5
3: 11
4: 92
1202860824_1202860835 4 Left 1202860824 14_GL000225v1_random:80006-80028 CCCGTCCCCGGGCTTCTGCGGGG No data
Right 1202860835 14_GL000225v1_random:80033-80055 TGCTTTCTGAAGGTGTCGGGAGG No data
1202860824_1202860839 16 Left 1202860824 14_GL000225v1_random:80006-80028 CCCGTCCCCGGGCTTCTGCGGGG No data
Right 1202860839 14_GL000225v1_random:80045-80067 GTGTCGGGAGGGCCATCGCGGGG 0: 5
1: 11
2: 7
3: 11
4: 42
1202860824_1202860836 5 Left 1202860824 14_GL000225v1_random:80006-80028 CCCGTCCCCGGGCTTCTGCGGGG No data
Right 1202860836 14_GL000225v1_random:80034-80056 GCTTTCTGAAGGTGTCGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202860824 Original CRISPR CCCCGCAGAAGCCCGGGGAC GGG (reversed) Intergenic
No off target data available for this crispr