ID: 1202864269

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:104948-104970
Sequence GTCTCACAAAAGCCCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202864261_1202864269 16 Left 1202864261 14_GL000225v1_random:104909-104931 CCTGGCTGGGCTGGAGCACGGGG 0: 9
1: 10
2: 35
3: 72
4: 786
Right 1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202864269 Original CRISPR GTCTCACAAAAGCCCCCTGT GGG Intergenic
No off target data available for this crispr