ID: 1202864361

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:105306-105328
Sequence GGAGCTCCATGGTGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202864361_1202864371 22 Left 1202864361 14_GL000225v1_random:105306-105328 CCCAGCTGCCACCATGGAGCTCC No data
Right 1202864371 14_GL000225v1_random:105351-105373 AGCTCTCTTTACCAGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202864361 Original CRISPR GGAGCTCCATGGTGGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr