ID: 1202864446

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:105925-105947
Sequence TACATCACCTGTTTGATCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202864442_1202864446 3 Left 1202864442 14_GL000225v1_random:105899-105921 CCTGTAAGCAGAACCTTGACAAG No data
Right 1202864446 14_GL000225v1_random:105925-105947 TACATCACCTGTTTGATCTGCGG No data
1202864440_1202864446 5 Left 1202864440 14_GL000225v1_random:105897-105919 CCCCTGTAAGCAGAACCTTGACA No data
Right 1202864446 14_GL000225v1_random:105925-105947 TACATCACCTGTTTGATCTGCGG No data
1202864445_1202864446 -10 Left 1202864445 14_GL000225v1_random:105912-105934 CCTTGACAAGGGTTACATCACCT 0: 13
1: 42
2: 282
3: 500
4: 644
Right 1202864446 14_GL000225v1_random:105925-105947 TACATCACCTGTTTGATCTGCGG No data
1202864441_1202864446 4 Left 1202864441 14_GL000225v1_random:105898-105920 CCCTGTAAGCAGAACCTTGACAA No data
Right 1202864446 14_GL000225v1_random:105925-105947 TACATCACCTGTTTGATCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202864446 Original CRISPR TACATCACCTGTTTGATCTG CGG Intergenic
No off target data available for this crispr