ID: 1202868711

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:139570-139592
Sequence ATAAAAGTGTTACATCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202868711_1202868713 -6 Left 1202868711 14_GL000225v1_random:139570-139592 CCTAGGTGATGTAACACTTTTAT No data
Right 1202868713 14_GL000225v1_random:139587-139609 TTTTATAAGCTCTGTCTACAGGG No data
1202868711_1202868714 27 Left 1202868711 14_GL000225v1_random:139570-139592 CCTAGGTGATGTAACACTTTTAT No data
Right 1202868714 14_GL000225v1_random:139620-139642 AACCTCTGCACTGATCACCTAGG No data
1202868711_1202868712 -7 Left 1202868711 14_GL000225v1_random:139570-139592 CCTAGGTGATGTAACACTTTTAT No data
Right 1202868712 14_GL000225v1_random:139586-139608 CTTTTATAAGCTCTGTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202868711 Original CRISPR ATAAAAGTGTTACATCACCT AGG (reversed) Intergenic
No off target data available for this crispr