ID: 1202872639

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177938-177960
Sequence CTGGTGCGAGGCCTGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872639_1202872660 25 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data
1202872639_1202872651 7 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872651 14_GL000225v1_random:177968-177990 CTCCGAGCCCGGGCATGGGCCGG No data
1202872639_1202872658 15 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872658 14_GL000225v1_random:177976-177998 CCGGGCATGGGCCGGGCCTGGGG 0: 3
1: 0
2: 1
3: 51
4: 453
1202872639_1202872659 18 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872659 14_GL000225v1_random:177979-178001 GGCATGGGCCGGGCCTGGGGTGG 0: 3
1: 1
2: 8
3: 138
4: 1092
1202872639_1202872656 14 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG 0: 3
1: 0
2: 2
3: 36
4: 428
1202872639_1202872645 -4 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872645 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG 0: 3
1: 0
2: 3
3: 22
4: 345
1202872639_1202872654 13 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872654 14_GL000225v1_random:177974-177996 GCCCGGGCATGGGCCGGGCCTGG 0: 3
1: 0
2: 5
3: 88
4: 819
1202872639_1202872646 -3 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872646 14_GL000225v1_random:177958-177980 CAGGGGCTCCCTCCGAGCCCGGG 0: 3
1: 0
2: 8
3: 40
4: 345
1202872639_1202872652 8 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872652 14_GL000225v1_random:177969-177991 TCCGAGCCCGGGCATGGGCCGGG 0: 2
1: 1
2: 0
3: 12
4: 216
1202872639_1202872647 2 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG 0: 2
1: 1
2: 1
3: 11
4: 168
1202872639_1202872648 3 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872648 14_GL000225v1_random:177964-177986 CTCCCTCCGAGCCCGGGCATGGG 0: 2
1: 1
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872639 Original CRISPR CTGGTGCGAGGCCTGCCAGC AGG (reversed) Intergenic
No off target data available for this crispr