ID: 1202872644

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177957-177979
Sequence CCGGGCTCGGAGGGAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872644_1202872656 -5 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG 0: 3
1: 0
2: 2
3: 36
4: 428
1202872644_1202872664 21 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872664 14_GL000225v1_random:178001-178023 GTCCCTGGAGCCCCCCTGACGGG No data
1202872644_1202872654 -6 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872654 14_GL000225v1_random:177974-177996 GCCCGGGCATGGGCCGGGCCTGG 0: 3
1: 0
2: 5
3: 88
4: 819
1202872644_1202872660 6 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data
1202872644_1202872658 -4 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872658 14_GL000225v1_random:177976-177998 CCGGGCATGGGCCGGGCCTGGGG 0: 3
1: 0
2: 1
3: 51
4: 453
1202872644_1202872667 29 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63
1202872644_1202872659 -1 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872659 14_GL000225v1_random:177979-178001 GGCATGGGCCGGGCCTGGGGTGG 0: 3
1: 1
2: 8
3: 138
4: 1092
1202872644_1202872663 20 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872644 Original CRISPR CCGGGCTCGGAGGGAGCCCC TGG (reversed) Intergenic
No off target data available for this crispr