ID: 1202872645

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177957-177979
Sequence CCAGGGGCTCCCTCCGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 3, 1: 0, 2: 3, 3: 22, 4: 345}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872639_1202872645 -4 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872645 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG 0: 3
1: 0
2: 3
3: 22
4: 345
1202872631_1202872645 28 Left 1202872631 14_GL000225v1_random:177906-177928 CCGGGAGCCACGCCTCAGCGAGA No data
Right 1202872645 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG 0: 3
1: 0
2: 3
3: 22
4: 345
1202872638_1202872645 -3 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872645 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG 0: 3
1: 0
2: 3
3: 22
4: 345
1202872634_1202872645 21 Left 1202872634 14_GL000225v1_random:177913-177935 CCACGCCTCAGCGAGAGGACGGA No data
Right 1202872645 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG 0: 3
1: 0
2: 3
3: 22
4: 345
1202872635_1202872645 16 Left 1202872635 14_GL000225v1_random:177918-177940 CCTCAGCGAGAGGACGGAGCCCT No data
Right 1202872645 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG 0: 3
1: 0
2: 3
3: 22
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872645 Original CRISPR CCAGGGGCTCCCTCCGAGCC CGG Intergenic
900244653 1:1631524-1631546 CCAGGGTCTCCCGGGGAGCCGGG - Intergenic
900597756 1:3490263-3490285 CCAGGGGCACGCTCTGGGCCTGG - Exonic
900603891 1:3515369-3515391 CCAGGTCCTCCCTCCCAGGCTGG + Intronic
900980135 1:6041569-6041591 CCAAGGGCTCCTTCCATGCCAGG - Intronic
900983408 1:6059397-6059419 CCAGGGGTTCCCAGCTAGCCTGG - Intronic
902289324 1:15426429-15426451 CCAGGATCTCACTCCGAGACAGG + Intronic
902776094 1:18675954-18675976 CCAGGAGCTGGCTCCAAGCCGGG + Intronic
903071672 1:20729881-20729903 CCTGGCGCTCCCTCCTATCCTGG + Intronic
903968316 1:27103089-27103111 CCAGGGGCTCCCTCTGCCCCAGG - Intronic
906544697 1:46612871-46612893 CCAGTGGCTCCCTCCCCGCCAGG + Intronic
907008293 1:50938278-50938300 CAAGGAGCTCCCTCCTGGCCAGG - Intronic
907053499 1:51345053-51345075 CCCGCGGCCCCGTCCGAGCCCGG - Exonic
913319815 1:117580323-117580345 CCAGGGTCTCCCTACGTGCCTGG - Intergenic
913332833 1:117681626-117681648 CCCTGGGCTCCCTCCGAAGCTGG + Intergenic
914490292 1:148147149-148147171 CCAGGGGTTCCCAGGGAGCCTGG - Intronic
915290089 1:154877732-154877754 CCACTGGCTCCCTGTGAGCCCGG - Intergenic
915980311 1:160416128-160416150 GCAGGGGCTCCCCGGGAGCCTGG - Exonic
916935799 1:169626894-169626916 CCAGGGGCTCCAGGCCAGCCTGG - Intronic
920493499 1:206437630-206437652 GCAGGGGCTCAGTCCCAGCCTGG + Intronic
921390248 1:214608064-214608086 CCAGGGGTTCCCAGGGAGCCTGG + Intronic
923461968 1:234215586-234215608 CCATGGGCTCCGACAGAGCCTGG + Intronic
924741590 1:246797312-246797334 CCAGGTGCTCCCTCCACCCCCGG + Intergenic
1062896744 10:1109077-1109099 CCAGGGGCTCCAACAGTGCCTGG - Intronic
1063020277 10:2119970-2119992 AAAGGGGCTCCCTGGGAGCCAGG - Intergenic
1063954376 10:11252740-11252762 CCACGTGCTCCCACAGAGCCAGG + Intronic
1066276190 10:33870930-33870952 ACAGGGTCTCCCTCCCAGGCTGG - Intergenic
1067083408 10:43225977-43225999 CCAGGGGCTGGGTCCCAGCCCGG + Intronic
1067722936 10:48743344-48743366 CCAGCGGCTCACTCCCACCCCGG + Exonic
1067844535 10:49709405-49709427 CCATGGGCTCCTTCCAGGCCTGG + Exonic
1070358263 10:75661544-75661566 CAAGGTCCTCCCTCCAAGCCTGG + Intronic
1070800908 10:79243787-79243809 CCCTGGGCTCCCTCCGGGCGCGG + Intronic
1070924242 10:80207607-80207629 CCAGGCGCTCTCTCTGGGCCCGG + Intergenic
1073098756 10:100996472-100996494 CCAAGGGCTCCCTCCCACCATGG - Intergenic
1073207079 10:101775144-101775166 CCTGGGGCTCCCGGCCAGCCCGG + Exonic
1073443257 10:103565146-103565168 TCAGGGGCTCCCCTGGAGCCAGG + Intronic
1073509464 10:104034271-104034293 CCAGGGGGTCCCTGCGGCCCAGG + Exonic
1074365068 10:112851218-112851240 CAAGGTGCTCCTTCAGAGCCTGG + Intergenic
1074943069 10:118253953-118253975 CCAGGGTCTCACTCTCAGCCTGG - Intergenic
1075416552 10:122268524-122268546 CCATGGCTTCCCTCCTAGCCCGG - Intergenic
1075646090 10:124097475-124097497 CCAAGGGCTCCCTCACACCCAGG - Intergenic
1075885406 10:125895960-125895982 CCAGGGGCTCCCTCCGAGCCCGG - Intronic
1076058219 10:127392693-127392715 CCAGGGGCTCAGTCTGAGTCAGG - Intronic
1076528411 10:131127384-131127406 CCGGGGGCTGCCTCCTGGCCTGG - Intronic
1076566824 10:131404587-131404609 ACAGGGCCTCCCTCCAATCCGGG + Intergenic
1076611538 10:131729019-131729041 CCAGGGGCTTCCTCGGAGCCGGG - Intergenic
1076649160 10:131975881-131975903 CCAGGGTCTGTCTCGGAGCCTGG + Intronic
1077052906 11:575848-575870 CCAGGTGCTCCCGCCGCGCGCGG + Intergenic
1077434219 11:2531022-2531044 CCAGGTGCTCCTGCCCAGCCAGG + Intronic
1077504473 11:2923731-2923753 CCAGGGGCCTCTTCCCAGCCAGG - Intronic
1080587207 11:33693062-33693084 GCAGGGGCTCCCTCCCTGCAGGG + Intergenic
1081874875 11:46401634-46401656 GCAGGGCCTCCCGCAGAGCCTGG - Intronic
1082782604 11:57299527-57299549 CCAGGGGCTCACTCTGACACTGG - Intergenic
1082828494 11:57598182-57598204 CCAGGGGCCCCCACCCCGCCCGG - Intronic
1083166520 11:60891426-60891448 CCAGTGCCTCCCTCAGTGCCTGG + Intronic
1083263454 11:61535526-61535548 CCAGGGCCTCCCTCCCTCCCGGG + Intronic
1083747153 11:64742919-64742941 ACAGGGGTTCGGTCCGAGCCCGG - Exonic
1083755223 11:64788588-64788610 CCAAGGGCTGCCTCAGTGCCAGG - Intergenic
1083780776 11:64916265-64916287 CCAGGGCCTCCCTCCAGGCAGGG + Intronic
1084151624 11:67290227-67290249 CAAGGGGCTCCCCCTGAGGCTGG + Intronic
1084199449 11:67545634-67545656 CCAGGAGCTCCCTCTGAGATGGG + Intergenic
1084334737 11:68450082-68450104 CCAGGGATTCCCTCCCTGCCAGG - Intergenic
1084446292 11:69205485-69205507 CCAAGGGCTTCCACCCAGCCGGG - Intergenic
1084530934 11:69727412-69727434 CCAGGAGATGCCTCCGAGCCAGG - Intergenic
1085019414 11:73195870-73195892 CCAGGGGCTCCCACACACCCTGG + Intergenic
1085297527 11:75439478-75439500 CCTGGGGCCCCCACCCAGCCAGG - Intronic
1085396792 11:76210487-76210509 CCAGGCGCGCCCTGCGTGCCCGG + Intronic
1086680267 11:89662645-89662667 CCAGGGACTCCCTGATAGCCTGG + Intergenic
1087644149 11:100787688-100787710 CCAGTGCCTCCCTCCACGCCTGG - Intronic
1088267314 11:108000296-108000318 CCTGTGGCTGCCTCCGACCCTGG - Intergenic
1088775547 11:113078949-113078971 CCAGGGAGTTCCTCCGAGCCGGG + Intronic
1089283008 11:117387467-117387489 CCAGGGACACCCTCTTAGCCTGG + Intronic
1090048655 11:123358497-123358519 CCAGCGGCTCCCGCCCCGCCTGG + Intergenic
1091058459 11:132440413-132440435 CCAGGGGCTGCCTCCATGGCTGG + Intronic
1091399752 12:174802-174824 GCAGGGGCTCCATGCGGGCCAGG - Exonic
1091787467 12:3251832-3251854 CTAGGGGCTCCCTGGGAGCCGGG - Intronic
1092192952 12:6533701-6533723 CCAGCGGCTCTCTCCGGGCTGGG - Intergenic
1092223453 12:6730996-6731018 CTTGGCGCTCCCTCGGAGCCTGG - Exonic
1098092880 12:66922857-66922879 ACAGGATCTCCCTCTGAGCCTGG + Intergenic
1098426184 12:70367090-70367112 CCAGGGGCTCCCCGCGAGGGAGG + Intronic
1100553911 12:95673093-95673115 CCAGGAGCACCCTCCTTGCCTGG + Intronic
1101446835 12:104742703-104742725 CCCGGGGCTCCCTTTCAGCCAGG - Intronic
1101969133 12:109300515-109300537 CCAGGGACGCACTCAGAGCCTGG + Intronic
1102199244 12:111046113-111046135 CCTGGGTCTTCCTCCCAGCCCGG + Intronic
1102253953 12:111405713-111405735 CCAGGAGAGCCCTCCGACCCTGG + Intergenic
1103400747 12:120641227-120641249 TCCGGGGCTCTCTGCGAGCCCGG + Exonic
1103724217 12:122989813-122989835 CCAGGGGCCCTCTCCAGGCCAGG + Exonic
1103976050 12:124703424-124703446 TCTGGGACTCCCTCCCAGCCAGG + Intergenic
1104128666 12:125872027-125872049 CCATGGCCTCCCCCTGAGCCAGG - Intergenic
1104191675 12:126487519-126487541 CCAAGGACTCCCTCTGTGCCAGG - Intergenic
1105378124 13:19863392-19863414 CCGGAGGCTCCCACCGACCCGGG - Intronic
1106040250 13:26083526-26083548 CCAGGGGCTGCCTCAGACTCCGG - Intergenic
1106231202 13:27822395-27822417 CCCTGGGCTACCTCCAAGCCCGG + Intergenic
1106480452 13:30133487-30133509 CCATGGGCTCCCTCCCGGCAAGG - Intergenic
1107024575 13:35786516-35786538 CCAGGGGCTCCCTTCCAGGAGGG - Intronic
1108699852 13:52934408-52934430 CCTGGGGCAGGCTCCGAGCCTGG + Intergenic
1111975912 13:94967636-94967658 CCCGGGGGTCCCTCGGAGCAGGG + Intergenic
1112402099 13:99086414-99086436 CCAGGTGCGCCCTCGGCGCCCGG + Intronic
1113750939 13:112776030-112776052 CCAGGGACTCCAGCCGGGCCAGG - Intronic
1113803022 13:113096257-113096279 CCAGGAGCTCCCACCGGGGCAGG + Intronic
1113896592 13:113768506-113768528 CCCGGGGCCCCCTCTGTGCCTGG + Intronic
1113896602 13:113768530-113768552 CCAGGTGCCCCCTCTGTGCCTGG + Intronic
1114055658 14:18965328-18965350 CCAGCTGCTCCCTGTGAGCCTGG + Intergenic
1114106888 14:19436435-19436457 CCAGCTGCTCCCTGTGAGCCTGG - Intergenic
1114612570 14:24052307-24052329 GCAGGGGCTGCCTTGGAGCCAGG - Intronic
1114634377 14:24179081-24179103 CCAGGGCCTCCCTCGGGACCTGG - Exonic
1114736651 14:25049769-25049791 CCTGGCGCTCCGTCCGAGGCGGG - Intronic
1116582815 14:46663640-46663662 CCAGGGACTCCCTCACTGCCTGG + Intergenic
1117882706 14:60327937-60327959 CAGGCGGCGCCCTCCGAGCCAGG - Intergenic
1119643261 14:76330156-76330178 CCAGAGCCTCCCTCAGAACCAGG - Intronic
1121333580 14:93063252-93063274 CCAAGGTCTGCCTCCAAGCCAGG + Intronic
1122213843 14:100190701-100190723 CCAGGGGTTCCATACCAGCCTGG + Intergenic
1122651961 14:103231131-103231153 TCAGGTGCTCTCTCTGAGCCTGG - Intergenic
1122721749 14:103726176-103726198 CCAGGGGTTCCCTCACAGGCGGG + Intronic
1123113166 14:105882356-105882378 CCTGGGGCTCCCACCGTGGCAGG - Intergenic
1123115516 14:105892508-105892530 CCTGGGGCTCCCACCGTGGCAGG - Intergenic
1202872645 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG + Intergenic
1123467270 15:20526511-20526533 CCAGGGCCACCCTCCCAGGCGGG + Intergenic
1123650845 15:22474531-22474553 CCAGGGCCACCCTCCCAGGCGGG - Intergenic
1123741253 15:23283373-23283395 CCAGGGCCACCCTCCCAGGCGGG - Intergenic
1123745744 15:23319185-23319207 CCAGGGCCACCCTCCCAGGCGGG + Intergenic
1123997639 15:25729878-25729900 CCAGTGCCTACCTCAGAGCCTGG + Intronic
1124278016 15:28342502-28342524 CCAGGGCCACCCTCCCAGGCGGG + Intergenic
1124291682 15:28457360-28457382 CCAGGGGATCCCAGAGAGCCTGG + Intergenic
1124304687 15:28569106-28569128 CCAGGGCCACCCTCCCAGGCGGG - Intergenic
1125501289 15:40241539-40241561 CCAGGTGCCACCTCCAAGCCTGG - Intronic
1125526504 15:40379200-40379222 CCAGGAGCTCCCGACCAGCCTGG + Intergenic
1128247720 15:66144313-66144335 CCAGGAGCTCCCTGAGAGCAAGG + Intronic
1128355759 15:66925324-66925346 CCAGGGCCTCCATCAGAGTCTGG + Intergenic
1129062193 15:72869039-72869061 CCAGGGGCTAGCTGAGAGCCAGG + Intergenic
1129266809 15:74397608-74397630 CCAGGGCCTCTCCCCCAGCCTGG + Intergenic
1129521907 15:76191527-76191549 CCAGGGCCCCCGTCCCAGCCTGG - Intronic
1129854194 15:78812065-78812087 GCAGGGGCTCCCGGGGAGCCTGG + Intronic
1131259232 15:90879998-90880020 CCACTGGCCCCCTCCCAGCCTGG - Intronic
1133799988 16:9077377-9077399 CCAGGGTCTGCCTCCAATCCAGG + Intergenic
1134001878 16:10789243-10789265 CCAGGTGCTTCCTCTGATCCAGG - Intronic
1134191022 16:12121343-12121365 ATAGGGGCTCCCCCAGAGCCTGG + Intronic
1135742591 16:24989153-24989175 TCAGGGGCTCCCTCCACACCTGG + Intronic
1136004919 16:27322924-27322946 CCACGGTCTCCCACCGAGTCAGG + Intronic
1136707100 16:32200313-32200335 CCAGGGGATCCCAGGGAGCCTGG - Intergenic
1136760810 16:32729104-32729126 CCAGGGGATCCCAGGGAGCCTGG + Intergenic
1136807293 16:33141282-33141304 CCAGGGGATCCCAGGGAGCCTGG - Intergenic
1137476136 16:48811294-48811316 CCAGGGAGTCCCCCAGAGCCCGG - Intergenic
1137592944 16:49704912-49704934 CCCTGGGCTCCCTCCTGGCCTGG + Intronic
1138524219 16:57592659-57592681 CCAGAGGCTCCCACTGTGCCAGG - Intergenic
1139778716 16:69333375-69333397 CCAGGGGCTCCAGACCAGCCTGG - Intronic
1139849156 16:69940274-69940296 CCAGGGGCTGCCGCAGAGGCCGG + Exonic
1142000228 16:87660131-87660153 ACAGGACCTGCCTCCGAGCCTGG + Intronic
1142185733 16:88693945-88693967 CCTGGGTCTCCCTCCCACCCTGG - Intergenic
1142299252 16:89247214-89247236 CCAGGGGCCGCCCCCGAGCGGGG + Intergenic
1142397948 16:89843349-89843371 CCCGGGCCTCCCTCAGGGCCAGG + Intronic
1203062962 16_KI270728v1_random:989418-989440 CCAGGGGATCCCAGGGAGCCTGG + Intergenic
1144758001 17:17691820-17691842 CCAGGTGCTACCTTCCAGCCTGG + Intronic
1144807384 17:17977056-17977078 TCAGGGGCTCCCTCTGCACCAGG + Intronic
1144942521 17:18951650-18951672 CATGGGGCTGCCTCTGAGCCTGG + Intronic
1145190884 17:20841752-20841774 CCAGGGGTTCCCAGGGAGCCTGG - Intronic
1146373844 17:32281357-32281379 CTAGGGGCTGCCTCCCAGGCTGG - Intronic
1146483746 17:33226761-33226783 CCAGGGGCTCTTTCCCTGCCTGG + Intronic
1147184397 17:38705606-38705628 CCATGAGCTCCCTCCGGGGCTGG - Exonic
1147196136 17:38768075-38768097 CCTGTGGCTCCCTCCAAACCTGG - Exonic
1147261089 17:39210149-39210171 CCAGAGGTGCCCTCCGAGACCGG - Intergenic
1147327225 17:39675249-39675271 CCAGTGGCTGCTCCCGAGCCTGG + Intronic
1147972643 17:44227807-44227829 CCAGAGCCCCCCTCCCAGCCAGG - Intergenic
1148059980 17:44829879-44829901 CGAGGGGTTCCCGCCGAGTCCGG - Intronic
1148556644 17:48582411-48582433 CCACGGGCTCCCTCAGAAGCCGG + Intronic
1151313773 17:73310098-73310120 CCAGGGGCTCTCTTAGGGCCTGG + Intronic
1151431079 17:74063672-74063694 GCAGTGGCTCCCACTGAGCCAGG + Intergenic
1152389153 17:79992478-79992500 CTACGGTCTCTCTCCGAGCCTGG - Intronic
1152521545 17:80859505-80859527 CCCGGGGCTCCCTGCCAACCTGG - Intronic
1152571141 17:81121771-81121793 CCACGGGCCTCCCCCGAGCCGGG - Exonic
1152589364 17:81203814-81203836 CCAGGGGCTCCCACGGGGCAGGG + Intronic
1152760533 17:82105067-82105089 CCAGGGGCACCCAGAGAGCCCGG - Intronic
1153820435 18:8827128-8827150 CCATGAGCACTCTCCGAGCCAGG + Intronic
1154207742 18:12352204-12352226 CCAGGAGCTCCTGCCGTGCCAGG - Intronic
1155018139 18:21866567-21866589 CCAGGTGCTCCCTCCTCACCAGG - Exonic
1155872301 18:31043031-31043053 CCAGGGCCTCTCTGCGGGCCGGG - Intergenic
1156036631 18:32772149-32772171 CGCCGGGATCCCTCCGAGCCGGG - Exonic
1158434754 18:57428054-57428076 CCAGGGCCTCTCTCCGTGCTAGG - Intergenic
1158445676 18:57518445-57518467 CCAGGGGGGACCTCAGAGCCAGG - Intergenic
1159003710 18:62994416-62994438 TCAGGGGCTCCCACTGTGCCTGG + Intergenic
1160242372 18:77132836-77132858 CCCCGGGCTTCCTGCGAGCCAGG + Intronic
1160957240 19:1699376-1699398 CCAGGGCCTCCCTCCCAGCGGGG - Intergenic
1161024223 19:2028113-2028135 CCAGGGGCTCCAGACCAGCCTGG + Intronic
1161265171 19:3360370-3360392 CCCGGGGGTCCCTCCCAGCTGGG - Intronic
1162320463 19:9968401-9968423 CCAGGGGGTCCCTGCACGCCTGG + Exonic
1162438610 19:10679170-10679192 CCTGGGGTCCCCTCCGAGGCTGG + Exonic
1162860995 19:13505845-13505867 CCCGGGTCTCTCTCCCAGCCTGG + Intronic
1163124620 19:15238265-15238287 CCAGGGGATGCCTCAGGGCCTGG - Exonic
1163157914 19:15449356-15449378 GCAGGTGCTTCCTCCGGGCCTGG - Intronic
1163315170 19:16536353-16536375 CCAGGGCCTCCTTATGAGCCGGG - Intronic
1163575693 19:18109870-18109892 CCTGGGGCTCTCTGGGAGCCGGG - Intronic
1165038893 19:33054920-33054942 CCAGGGGATACCTCCCAGCCAGG + Intronic
1165074656 19:33273975-33273997 CCTCAGGCTCCCTCAGAGCCTGG - Intergenic
1165395718 19:35562620-35562642 CCAGGGCCTCTCTGCGAGCCTGG - Exonic
1165423952 19:35735532-35735554 CCAGGGGCTCCCTTCCAGCTTGG + Intronic
1166644427 19:44520489-44520511 CAAGGGGCTCACTCCGGGCCCGG + Exonic
1167428203 19:49440486-49440508 ACAGGGACTCCCTCCCAACCAGG - Intronic
1167451532 19:49572995-49573017 CCAGGGTCTGCTTCAGAGCCGGG - Intronic
925165784 2:1714809-1714831 CCAGGGGCCCCATCTGACCCAGG - Intronic
925357544 2:3252746-3252768 TCAGGGGCTCCATCCCTGCCGGG + Intronic
925388882 2:3482422-3482444 GCAGGGGCTACCTCTGGGCCTGG - Intronic
925443762 2:3910150-3910172 CCAGTGGCTGCCTCTGTGCCTGG - Intergenic
925580093 2:5401457-5401479 CAAGGTGCTGCCTCCCAGCCTGG - Intergenic
926062608 2:9813669-9813691 CCAGGGGTTCCCAGGGAGCCTGG - Intergenic
926329066 2:11810066-11810088 CTAGGGGCTCCCTCTGAGTTTGG - Intronic
929596355 2:43178771-43178793 CCCTGGGCTCCCTCCCAGGCAGG - Intergenic
931408326 2:62002824-62002846 ACAGGGTCTCCCACCCAGCCTGG - Intronic
932307953 2:70717103-70717125 CCAGGAGCTCCCTCTAGGCCTGG + Intronic
932479104 2:72028007-72028029 TCAGGAGCTCCCTCAGAGCCAGG + Intergenic
933804293 2:85987185-85987207 CCCAGGGCTCCCTCCCAGGCAGG + Intergenic
933941459 2:87248450-87248472 CCAAGGGCTACCTCCTGGCCAGG - Intergenic
934504203 2:94878820-94878842 CCAGCAGCTCCCTCTGAGGCTGG - Intergenic
934954908 2:98609059-98609081 CCAGCTGCTCCCTCCCTGCCCGG - Intronic
935373163 2:102368516-102368538 GCAGGGGCTCACTGGGAGCCAGG + Intronic
935590273 2:104841934-104841956 CCAGGGCCTCCCTCCCTCCCTGG - Intergenic
936338765 2:111613141-111613163 CCAAGGGCTACCTCCTGGCCAGG + Intergenic
937078557 2:119124604-119124626 CCATGGGCTCCTTCCCAGCTTGG - Intergenic
937340620 2:121088458-121088480 CGCGGGGCTCCCACCCAGCCTGG - Intergenic
937376700 2:121341289-121341311 CCAAAGGCTCCATCAGAGCCAGG + Intronic
937956766 2:127426202-127426224 CCAGGGGCTGTCTCCCCGCCTGG - Exonic
938292892 2:130159767-130159789 CCAGGCCCTCCCTCCAATCCTGG + Intronic
938370186 2:130763663-130763685 CTAGGGGCTCCCTGGGAACCAGG - Exonic
938463665 2:131513197-131513219 CCAGGCCCTCCCTCCAATCCTGG - Intergenic
941856537 2:170236780-170236802 CCAGGGACTCCTTCCCAACCAGG + Intronic
941996984 2:171610505-171610527 CCAGGGACTGCCTGTGAGCCAGG + Intergenic
942043821 2:172087693-172087715 CCAGGGGCTCAGTCCGACCGTGG - Intronic
943528231 2:189045852-189045874 CCAGGGGCACCCTGAGAGCCTGG + Exonic
946520360 2:220457873-220457895 TCAGAGCCTCCCTCCAAGCCTGG + Intergenic
947716578 2:232342781-232342803 CCAGGGGCCCCAGCCCAGCCTGG - Intronic
947793309 2:232879734-232879756 ACAGAGGCTCCCTCCTGGCCAGG + Intronic
948459245 2:238121167-238121189 CCAGGGGCTGCCCTCGAGGCAGG + Intronic
948587076 2:239026238-239026260 CCAGGGCCTCCCTGGCAGCCTGG - Intergenic
948653669 2:239464129-239464151 GCCGGGGCTCCATCCCAGCCAGG - Intergenic
948953438 2:241270222-241270244 CCAGGGTCTCCCTCAGACACAGG - Intronic
948975989 2:241464223-241464245 CCAGGGTCCCCCTCAGAGCAGGG + Intronic
1172008047 20:31830878-31830900 CCAGGTGGTACCTCCGTGCCAGG - Exonic
1172118994 20:32586596-32586618 CGTGGGGCTCTCTCCGAGCGCGG - Intronic
1172547370 20:35772227-35772249 CCAGGGCCTCCCTCCAGGCTGGG - Intronic
1172670493 20:36631710-36631732 CCAGGAGCTCCCTGAGAGCAGGG + Intronic
1173865097 20:46308176-46308198 CAGGGGGCTCCCTCCCTGCCGGG + Intronic
1174247506 20:49192769-49192791 TCAGGGTCTCACTCCAAGCCTGG - Intergenic
1174475067 20:50790715-50790737 ACAGTGGCTCCATCCCAGCCTGG - Intergenic
1175750568 20:61494129-61494151 GCAGGGGCTCACACCCAGCCCGG - Intronic
1176377083 21:6092088-6092110 CCCGGGGCTCCCTTGGAGGCAGG - Intergenic
1178314876 21:31559291-31559313 CCAGCCGCGCGCTCCGAGCCTGG - Intronic
1178888626 21:36501783-36501805 CCAGGGGCTGGCTGGGAGCCTGG - Intronic
1178916841 21:36709514-36709536 CCAGGGGCGCCTCCCGAGCGTGG + Intronic
1179385988 21:40942409-40942431 CCTGGGGCTTTCTCCCAGCCTGG + Intergenic
1179746392 21:43446156-43446178 CCCGGGGCTCCCTTGGAGGCAGG + Intergenic
1179801354 21:43812911-43812933 CCTGGGGTTCCCTCAGATCCTGG + Intergenic
1180180657 21:46117424-46117446 CCAGGGTCTCCCTTGCAGCCAGG - Exonic
1180219710 21:46350773-46350795 CCAGGCTCTCCCTCCGAGATGGG + Intronic
1180285450 22:10741519-10741541 CCCGGGGCTCCCTCGGAGCCCGG - Intergenic
1180474134 22:15687880-15687902 CCAGCTGCTCCCTGTGAGCCTGG + Intergenic
1181121395 22:20670211-20670233 CCAGGGGTTCCCAGGGAGCCTGG + Intergenic
1181533802 22:23531595-23531617 CCAGGGGAGCCCGCCCAGCCTGG + Intergenic
1182285273 22:29243451-29243473 CCAGGGTCTCCCTTAGGGCCAGG - Exonic
1183364275 22:37399035-37399057 CCCTGAGCTCCCTCCGGGCCAGG - Intronic
1183370815 22:37431181-37431203 TCAGGGGCTCGCTCAGGGCCAGG + Intergenic
1183715664 22:39532254-39532276 CCAGGGCCCCGCTCCGCGCCTGG + Intronic
1184287106 22:43477933-43477955 CCAGGGCCTTCCTTTGAGCCAGG - Intronic
1184610759 22:45601805-45601827 CCAGGGGCTCCCTGTGCCCCAGG + Intergenic
1184754242 22:46507462-46507484 CCAGCGGCTCCCTCCCTCCCCGG + Intronic
1184756715 22:46520244-46520266 CCAGGGCCTCCTTCTGAGCTCGG - Intronic
1185280634 22:49968443-49968465 GGAGGGGCTCCCTCAGACCCAGG - Intergenic
1185417812 22:50719898-50719920 CCAGGGTCTTGCTCGGAGCCCGG + Intergenic
1185419643 22:50728319-50728341 CCAGAGGCACCCACGGAGCCAGG - Intergenic
950089796 3:10287548-10287570 CCAGTGGCTACCTCGGTGCCTGG + Intronic
950453484 3:13078816-13078838 CCAGGGGGTTCTTCCAAGCCTGG + Intergenic
950964798 3:17138757-17138779 CAAGGGGCCCCCTCAGGGCCAGG - Intergenic
953070113 3:39511745-39511767 CCAGGGCCTCACTCAGGGCCTGG + Intronic
953902313 3:46850237-46850259 CCAGGGCCCCCCACTGAGCCTGG + Intergenic
954135799 3:48581580-48581602 CCAGGGTCTCCCTTGGGGCCAGG + Exonic
961187230 3:124926363-124926385 CCAGGTGTTCCCTCAGAGTCAGG - Intronic
961203627 3:125063469-125063491 CCAGTGACTCCATCAGAGCCTGG - Intergenic
961810914 3:129521239-129521261 CCAGGGGCTGCCTCCAGCCCTGG + Intergenic
961861025 3:129916857-129916879 CCTGGGGCTCCCTGAGAGGCTGG + Intergenic
964346877 3:155762725-155762747 ACAGGAGCTCCCACCAAGCCTGG - Exonic
966516019 3:180821514-180821536 CCAGTGGCTCCATCCTGGCCTGG + Intronic
966555166 3:181250944-181250966 CCAGCTGCTCTCTCCAAGCCTGG - Intergenic
967054943 3:185823756-185823778 GAAGGGGCTCCCGCCGGGCCGGG + Intronic
967204632 3:187108318-187108340 CCATGGGCTCCCTCTTAGCAAGG - Intergenic
967869488 3:194218320-194218342 CCAGGGCCCCCCTCCTAGGCTGG - Intergenic
968353500 3:198081315-198081337 CCAGTGGCTGCGGCCGAGCCAGG - Intergenic
968799740 4:2733991-2734013 CCAGGGGCTCCCATCAAGTCAGG - Intergenic
969263721 4:6050519-6050541 CCAAGGGCTCGCTCAGTGCCCGG - Intronic
969694259 4:8725806-8725828 CCACGGCCTCCCTAAGAGCCAGG + Intergenic
985704849 5:1394388-1394410 CCTGGGGCAGCCTCAGAGCCGGG + Exonic
985761873 5:1753092-1753114 CCACCGGCTCCCTCTGGGCCTGG + Intergenic
985823720 5:2178236-2178258 CCCAGGGCTCCCTCAGCGCCAGG - Intergenic
986164927 5:5265029-5265051 TCAGGGGCTCCCTCTGTGCCTGG + Intronic
987114237 5:14713756-14713778 CCAGGGGCTGCCTAGGACCCTGG + Intronic
992464707 5:76992178-76992200 ACATGGGCTACCTCAGAGCCTGG + Intergenic
994072983 5:95621487-95621509 CCAGCGGTTCCCGCCGAGCATGG - Exonic
997234800 5:132266572-132266594 CCCTGGGCTCACTCTGAGCCAGG - Intronic
1000339973 5:160269462-160269484 CCAGGGGCTGCCTCTGGCCCAGG + Intronic
1001282974 5:170401124-170401146 CCAGAGACTCTCTCTGAGCCAGG + Intronic
1002279917 5:178124067-178124089 CCAGAGGGCCCCTCAGAGCCAGG + Exonic
1002792208 6:444946-444968 GCAGGGGCCCCCTCGGTGCCAGG - Intergenic
1003307315 6:4941273-4941295 GCAGGGGCTGCCTTCAAGCCTGG - Intronic
1004350275 6:14884597-14884619 CAAAGAGCTCCCTCCGATCCTGG - Intergenic
1005533583 6:26733113-26733135 CCTCGGCCTCCCACCGAGCCTGG - Intergenic
1005535067 6:26746563-26746585 CCTCGGCCTCCCACCGAGCCTGG + Intergenic
1005537212 6:26768541-26768563 CCTCGGCCTCCCACCGAGCCTGG + Intergenic
1006296356 6:33171738-33171760 CCAGGGGGACCCTGCGGGCCTGG + Exonic
1007215552 6:40234791-40234813 CCAGGAGCTCCATCCCAGCAAGG - Intergenic
1013355472 6:109342479-109342501 CCAGGGCCTGCCTGAGAGCCAGG - Intergenic
1015785856 6:136921629-136921651 CCAGGGGGTGCCTCGGAGCCCGG - Intergenic
1017282093 6:152636712-152636734 CCCCGGGGTCCCGCCGAGCCTGG - Exonic
1018873347 6:167799558-167799580 CCAGGCGCGCCCTCAGAGCCTGG + Intergenic
1019313699 7:375013-375035 GCAGAGGCTGCCTCTGAGCCCGG - Intergenic
1019429633 7:992702-992724 GCTGGGGCTCCCTCAGAGCGGGG + Intergenic
1019574223 7:1728545-1728567 CCAGGAGGTGCCTCCGAACCAGG - Intronic
1019644244 7:2120601-2120623 CCAGAGGCTTCCTCAGAGCCAGG + Intronic
1022011485 7:26311358-26311380 CCAGGGGCTCCAGACCAGCCTGG - Intronic
1024222785 7:47301486-47301508 CCAGGGGCTGTCTCCAAGCAGGG + Intronic
1024639141 7:51316123-51316145 CCTGGGGCTGCCGCCGAGGCCGG + Intronic
1026266406 7:68799387-68799409 CCAGGAGTTCCATCCCAGCCTGG - Intergenic
1026553323 7:71386004-71386026 CCAGAGGGTCCCTCAGAGGCTGG - Intronic
1026765013 7:73154946-73154968 CCAGCTGCTCCCCCCGCGCCGGG + Intergenic
1026898046 7:74021917-74021939 CCAGGGGCTCCTGCTGGGCCTGG - Intergenic
1027734068 7:81909917-81909939 CCATGGGCTCCCACAAAGCCAGG + Intergenic
1029575199 7:101398926-101398948 CCAGGGGCTCACTCCACACCTGG - Intronic
1030121213 7:106112318-106112340 CCCGGGCCCGCCTCCGAGCCCGG - Intronic
1034497635 7:151431944-151431966 CCAGGGGGTCCCTGGGAGTCCGG + Intronic
1034551324 7:151822517-151822539 CCAGGGGCTCCCTTGGGGCTGGG + Intronic
1034996769 7:155582256-155582278 CCATGGGCTCCCTCCAAGCCTGG - Intergenic
1035056248 7:156038764-156038786 GAAGGGGCTCCCTCGGAGACAGG + Intergenic
1037826416 8:22163121-22163143 CCAGGTGCTCACTCAGGGCCAGG - Exonic
1038467120 8:27774512-27774534 GCAGCGGCTTCCTCCTAGCCTGG + Exonic
1039703280 8:39982699-39982721 CTTGGGGCTCCCTCCTATCCTGG + Exonic
1042521066 8:69711366-69711388 CTCGGGGGTCCCTCCGAGGCTGG - Intronic
1046981900 8:120345470-120345492 CCAGGGGCTCCAGGTGAGCCTGG - Exonic
1049177869 8:141205600-141205622 CCGGGTGTTCCCTCCTAGCCTGG + Intergenic
1049624134 8:143612557-143612579 CCAGGGACTGCCCCCTAGCCTGG - Intergenic
1049804034 8:144530899-144530921 CCAGGGGTGCCCGCCGAGCAGGG - Intronic
1050388468 9:5113050-5113072 CCAGGAGCTCCCTGGGACCCCGG + Intronic
1054823039 9:69543181-69543203 CCAGGGGCTCCCTCCAATTAGGG - Intronic
1055346623 9:75346357-75346379 CCATGGGCACCCTCTGAGCCAGG + Intergenic
1055757574 9:79572481-79572503 CGAGGCGCACCCGCCGAGCCCGG - Intronic
1056578333 9:87872416-87872438 CCAGGGGCTGCCTGTGTGCCAGG - Intergenic
1057880271 9:98787915-98787937 CCATGTGCTCCCTCTGGGCCAGG + Intronic
1058801811 9:108551784-108551806 TCTGGGGCTCCCCCGGAGCCAGG - Intergenic
1059561787 9:115341674-115341696 CCAGGAGCTGCCTCCAGGCCTGG + Intronic
1060822816 9:126671390-126671412 CCAGGGGCCCCAGCTGAGCCCGG - Intronic
1060830698 9:126713596-126713618 CCAGGGGCTCCAGACCAGCCTGG - Intergenic
1060971157 9:127738895-127738917 CCAGGAGCTCCGGCCGGGCCTGG + Exonic
1062227299 9:135460076-135460098 CCAGGGGCTCCCTTGGAGCTGGG - Intergenic
1062357582 9:136172081-136172103 CCAGGGGCTCCCACTGTGCTGGG + Intergenic
1062412986 9:136434116-136434138 CCAGGAGCTCCCGCCCAGCCTGG - Exonic
1062452336 9:136620934-136620956 CCAGTGCCTCCCTCCGCGCCGGG + Intergenic
1062677451 9:137755255-137755277 CCAGGGGCTGCCTGGGAGCAGGG - Intronic
1203731812 Un_GL000216v2:98585-98607 CCAGGGGCTCCCTCCGAGCCCGG - Intergenic
1203745018 Un_GL000218v1:36761-36783 CCAGCAGCTCCCTCTGAGGCTGG + Intergenic
1203565088 Un_KI270744v1:82723-82745 CCAGCAGCTCCCTCTGAGGCTGG - Intergenic
1186502714 X:10064879-10064901 CCAGTGGCTCTCTGCCAGCCTGG + Intronic
1188247629 X:27854370-27854392 CCTGGGTCTCACTTCGAGCCTGG - Intergenic
1188472601 X:30557371-30557393 CCAGGGGCTCCCTGTGAGATGGG + Intergenic
1189204713 X:39227815-39227837 CCAGGTGCTGCCTCTGAGCCTGG + Intergenic
1194415387 X:93605829-93605851 CCAGATGCTCCCTCCATGCCTGG - Intergenic
1195269413 X:103215397-103215419 CCGCCGGCTCCCTCCGGGCCGGG - Intronic
1195753510 X:108179321-108179343 CCAGTGGCTCCCTTGGAACCAGG + Exonic
1197773708 X:130106816-130106838 CCAGGATCTCCCACCGAGCTGGG - Intronic
1199482665 X:148314272-148314294 CCAGGGCCTACCTCAGGGCCTGG + Intergenic
1199482710 X:148315125-148315147 CCAGGGCCTACCTCAGGGCCTGG - Intergenic
1199608267 X:149593629-149593651 CCAGGGCCTCCAACCCAGCCGGG - Intronic
1199616039 X:149656921-149656943 CCATGGACTGCCTCAGAGCCAGG - Intergenic
1199626601 X:149746327-149746349 CCATGGACTGCCTCAGAGCCAGG + Intergenic
1199630853 X:149775731-149775753 CCAGGGCCTCCAACCCAGCCGGG + Intronic
1199748852 X:150795354-150795376 CATGGGGCTCCCTCTGAGACAGG - Intronic
1200045143 X:153397095-153397117 CCTGGGGCTCCTCCCCAGCCCGG - Intergenic
1200117969 X:153777422-153777444 CCAGGGACCCCGACCGAGCCAGG + Intronic
1200240563 X:154490896-154490918 CCTGGGGCTCCCTCCCAGAGCGG - Intergenic
1201317651 Y:12663257-12663279 CCGGGGCCTCACTCAGAGCCAGG + Intergenic