ID: 1202872646

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177958-177980
Sequence CAGGGGCTCCCTCCGAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 3, 1: 0, 2: 8, 3: 40, 4: 345}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872634_1202872646 22 Left 1202872634 14_GL000225v1_random:177913-177935 CCACGCCTCAGCGAGAGGACGGA No data
Right 1202872646 14_GL000225v1_random:177958-177980 CAGGGGCTCCCTCCGAGCCCGGG 0: 3
1: 0
2: 8
3: 40
4: 345
1202872635_1202872646 17 Left 1202872635 14_GL000225v1_random:177918-177940 CCTCAGCGAGAGGACGGAGCCCT No data
Right 1202872646 14_GL000225v1_random:177958-177980 CAGGGGCTCCCTCCGAGCCCGGG 0: 3
1: 0
2: 8
3: 40
4: 345
1202872631_1202872646 29 Left 1202872631 14_GL000225v1_random:177906-177928 CCGGGAGCCACGCCTCAGCGAGA No data
Right 1202872646 14_GL000225v1_random:177958-177980 CAGGGGCTCCCTCCGAGCCCGGG 0: 3
1: 0
2: 8
3: 40
4: 345
1202872638_1202872646 -2 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872646 14_GL000225v1_random:177958-177980 CAGGGGCTCCCTCCGAGCCCGGG 0: 3
1: 0
2: 8
3: 40
4: 345
1202872639_1202872646 -3 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872646 14_GL000225v1_random:177958-177980 CAGGGGCTCCCTCCGAGCCCGGG 0: 3
1: 0
2: 8
3: 40
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872646 Original CRISPR CAGGGGCTCCCTCCGAGCCC GGG Intergenic
900189798 1:1348582-1348604 CAGGCGCTCCCGGCCAGCCCCGG + Intronic
900237942 1:1601347-1601369 CAGGGGCTCTGCCAGAGCCCCGG + Intergenic
900318946 1:2073078-2073100 CTGGGTCTCCCTAGGAGCCCGGG + Intronic
900378752 1:2373388-2373410 GAGGGTCTCCCTCCGAGCCAAGG - Intronic
900457644 1:2785303-2785325 CAGGAGATCCCTGCGAGTCCTGG + Intronic
900498332 1:2987089-2987111 CAGGGGCTCCCCCCATTCCCAGG + Intergenic
901811393 1:11768672-11768694 CAGATGCTCCCTCCCAGCCCTGG - Intronic
902884221 1:19393356-19393378 CAGGGGCTCCCGCTCACCCCAGG + Intronic
903182425 1:21611648-21611670 CAGGGGCTCCCTCCCTGCCCAGG + Intronic
903228485 1:21907259-21907281 CAGGGGCTCACTCCCAGGGCCGG + Intronic
903328347 1:22584178-22584200 CACAGGCTCCTTCTGAGCCCCGG - Intronic
903861056 1:26364787-26364809 CAGGGTCTCCCACCGAGCGCTGG + Exonic
904747676 1:32720936-32720958 CCGTGGCTCCCTCCCAGCCCTGG - Intergenic
905435482 1:37952532-37952554 CATGGGCTTCCTCAGAACCCAGG + Intergenic
905627575 1:39498788-39498810 CAGCGGCTCCCCCAGAGCCCCGG - Intronic
905638997 1:39576016-39576038 AAGGGGCGCCTTCGGAGCCCGGG + Exonic
905668849 1:39778320-39778342 CAGCGGCTCCCCCAGAGCCCCGG + Intronic
905870193 1:41399185-41399207 CAGGGCAGCCCTCCCAGCCCTGG + Intergenic
906005153 1:42462985-42463007 CAGGGGCTCCAGCTGAGTCCTGG + Intronic
906320738 1:44813780-44813802 CGAGGGCTCCCTGCGAGTCCCGG - Exonic
907667968 1:56449952-56449974 AAGGGGCTCACACCCAGCCCAGG + Intergenic
908796187 1:67833239-67833261 CGGGGGCCGCCTCCGAGTCCCGG - Intronic
914843077 1:151264311-151264333 CAGGGTCTCCCTATGTGCCCAGG - Intronic
915298684 1:154939786-154939808 CAGGGTCTCACTCTGTGCCCAGG + Intergenic
915315462 1:155026270-155026292 CAGGGACTAGCTCCCAGCCCCGG + Intronic
915901115 1:159847273-159847295 GATGGTCTCCCTCTGAGCCCAGG - Intronic
917795383 1:178529286-178529308 CAGGGGGTCCCTCAGAGCTAAGG - Intronic
918314171 1:183309041-183309063 CAGGGTCTCACTCTGTGCCCTGG + Intronic
919723725 1:200867529-200867551 CATGGGCTCACTCCGTTCCCTGG - Intergenic
919753819 1:201054288-201054310 TAGCGGCTTCCTCAGAGCCCTGG - Intronic
920139274 1:203795977-203795999 CTGGGGCTCCCAGCCAGCCCCGG - Intronic
921051619 1:211515497-211515519 CAGGACCTCCCTCCGGGCCGAGG + Intergenic
924436718 1:244049026-244049048 CTGGCGCCCCCTCCGCGCCCCGG + Intronic
1065966683 10:30776242-30776264 GAGGGGTTCCCTCTCAGCCCTGG + Intergenic
1066048387 10:31614063-31614085 CAGGGGCTCCTCCCGACTCCAGG - Intergenic
1066464488 10:35640737-35640759 GCGCGGCTCCCTGCGAGCCCGGG - Exonic
1067436952 10:46284966-46284988 CTGCGGCTCCCTCCGCGCCGTGG + Intergenic
1069881568 10:71596870-71596892 CAGGGCCTGCCTCCCAGCCCCGG + Intronic
1070536418 10:77381464-77381486 CATGGGCTCCCTCCAGGCCTCGG + Intronic
1070797020 10:79222792-79222814 CAGGGTCTTTCTCTGAGCCCTGG - Intronic
1070800910 10:79243788-79243810 CCTGGGCTCCCTCCGGGCGCGGG + Intronic
1070881750 10:79857192-79857214 CAGGGGCTCCCTGCAAGCTGAGG + Intergenic
1070924243 10:80207608-80207630 CAGGCGCTCTCTCTGGGCCCGGG + Intergenic
1071208600 10:83312733-83312755 CAGTGGCCCCCTGCCAGCCCTGG + Intergenic
1071648327 10:87373506-87373528 CAGGGGCTCCCTGCAAGCTGAGG + Intergenic
1072207957 10:93221296-93221318 AGGCGGCTCCCTCGGAGCCCAGG + Intergenic
1072753035 10:97997425-97997447 CAGAGTCTCCCTCTGTGCCCAGG - Intronic
1072878793 10:99203631-99203653 CAGGAGCTCCCTGTGGGCCCAGG + Intronic
1073146635 10:101285699-101285721 CTGGGGCTCTCCCCGAGGCCAGG - Intergenic
1073460294 10:103661960-103661982 CAGGCGCTGCCACCGAGCCCAGG + Intronic
1074696032 10:116050935-116050957 CAGGGGCTCCCTGCTCGCACAGG + Intergenic
1075885405 10:125895959-125895981 CAGGGGCTCCCTCCGAGCCCGGG - Intronic
1076430940 10:130401882-130401904 CAGGGGCTTCCTGGGAACCCTGG + Intergenic
1076566825 10:131404588-131404610 CAGGGCCTCCCTCCAATCCGGGG + Intergenic
1077052907 11:575849-575871 CAGGTGCTCCCGCCGCGCGCGGG + Intergenic
1077199347 11:1297697-1297719 CAGGGGGTCCCTCCGGGCCCTGG - Intronic
1077253277 11:1570104-1570126 GGGGGGCTCCCTCCGATCCCAGG + Intronic
1077320442 11:1938590-1938612 CAGGGGCTCCCTGACAGTCCTGG + Exonic
1077328289 11:1973042-1973064 CAGGGGCTCCAGGCGAGCTCTGG + Intronic
1077532439 11:3103555-3103577 CAGGGGCACCCTGGCAGCCCAGG - Intronic
1078363151 11:10685695-10685717 CAGGGTCTCACTCTGACCCCTGG - Intronic
1078610202 11:12813184-12813206 TGGGGGCTCCCTGGGAGCCCTGG + Intronic
1078736872 11:14028445-14028467 CAGGGTCTCACTCTGTGCCCCGG - Intronic
1079192396 11:18290894-18290916 CAGGGTCTCACTCTGTGCCCAGG - Intronic
1080587208 11:33693063-33693085 CAGGGGCTCCCTCCCTGCAGGGG + Intergenic
1081599924 11:44485867-44485889 CCGGGTCTCCCTCCCACCCCTGG + Intergenic
1081710132 11:45210984-45211006 CTCGGGCTCCCTGCCAGCCCAGG - Intronic
1081806738 11:45895013-45895035 CACGTGCTCCCTCTGAGCACTGG + Intronic
1081874874 11:46401633-46401655 CAGGGCCTCCCGCAGAGCCTGGG - Intronic
1081989544 11:47330413-47330435 CAGGGCCTCCCACAGGGCCCCGG + Intergenic
1082828493 11:57598181-57598203 CAGGGGCCCCCACCCCGCCCGGG - Intronic
1083478242 11:62927311-62927333 CCGGGCCCCCCTCCCAGCCCAGG - Intergenic
1083609541 11:63998493-63998515 CAGGGGCTCCATCCAACACCTGG + Intronic
1083891997 11:65600091-65600113 CAGGGGCAACCTCCAGGCCCAGG + Intronic
1084183037 11:67455991-67456013 CTGGAGCTCCCACAGAGCCCTGG - Intronic
1084225082 11:67710841-67710863 CAGGGTCTACTTCCGAGCCACGG - Intergenic
1084540773 11:69785500-69785522 CAGGGTCTCCCTCCGAACCCAGG + Intergenic
1085183284 11:74554226-74554248 CAGGGGATCACTCTGAGTCCAGG - Intronic
1085396793 11:76210488-76210510 CAGGCGCGCCCTGCGTGCCCGGG + Intronic
1088613714 11:111602706-111602728 CGGACGCTCCCGCCGAGCCCCGG - Intronic
1088977588 11:114829607-114829629 AAGAGGCTCCCACCTAGCCCTGG - Intergenic
1089540953 11:119188674-119188696 CAGAGGCTCCCGCCTCGCCCCGG + Exonic
1089563397 11:119357157-119357179 CAGGGGCTCCGGCCCTGCCCTGG + Intronic
1090464411 11:126921197-126921219 CAGGGGCTCCCCCAGATCTCAGG + Intronic
1202811267 11_KI270721v1_random:28221-28243 CAGGGGCTCCAGGCGAGCTCTGG + Intergenic
1091937396 12:4444762-4444784 CAGCGGCTCCCTCTGTCCCCAGG - Intronic
1095533918 12:43224245-43224267 AAGGGGCTCCCACAGTGCCCCGG - Intergenic
1096037927 12:48489449-48489471 CAGGGTCTCACTCTGTGCCCAGG + Intronic
1096106509 12:48999330-48999352 CAGGAGCCCCCTCCCAGCCCAGG + Intergenic
1096215315 12:49795144-49795166 CAGGGGCTCGCTCCTGGCCCTGG + Exonic
1097058812 12:56267281-56267303 CAGGGGGTCGCTGCGAACCCCGG + Intronic
1097277273 12:57822084-57822106 CAGGAGCGCCCTCCCACCCCAGG + Exonic
1099369390 12:81811624-81811646 CAGGGGCTCCCTCTGGTCTCAGG - Intergenic
1099719307 12:86341193-86341215 CAGGGGATCCTCCCCAGCCCAGG + Intronic
1102243779 12:111342117-111342139 GTGGGGCTCCCTCCAGGCCCTGG - Intronic
1103400749 12:120641228-120641250 CCGGGGCTCTCTGCGAGCCCGGG + Exonic
1103976051 12:124703425-124703447 CTGGGACTCCCTCCCAGCCAGGG + Intergenic
1104934051 12:132355145-132355167 CAGGGCCTCCCTGCGAGCTCCGG - Intergenic
1105001158 12:132689646-132689668 CAGTGGCTCCCTCCAGGCCTTGG - Intronic
1105837388 13:24223406-24223428 CAGGGGCTCCCCCTTAGCACCGG + Exonic
1105871913 13:24512794-24512816 CAGTGGCGCCCGCCCAGCCCCGG - Exonic
1107166390 13:37286070-37286092 CAGGGGCTCCTAGGGAGCCCTGG - Intergenic
1107484696 13:40814221-40814243 AAGGGGCTCCCCCAGGGCCCAGG + Intergenic
1108541889 13:51452975-51452997 CAGGGACTCCCTCCGCACCCCGG + Exonic
1111040358 13:82740181-82740203 GAGGGGCTCCCTCAAGGCCCAGG - Intergenic
1112394253 13:99014056-99014078 CAGGGGCTCTGTCAGAGCTCTGG - Intronic
1113026297 13:105944962-105944984 CAGAGTCTCGCTCTGAGCCCAGG + Intergenic
1113334777 13:109367237-109367259 CAGAGGCACACTCTGAGCCCAGG + Intergenic
1114469632 14:22951024-22951046 CAGGGTCTCACTCTGTGCCCAGG + Intronic
1115246715 14:31303084-31303106 CAGGGTCTCACTCTGTGCCCAGG - Intronic
1115783386 14:36796516-36796538 CAGGCGCTCCATCAGATCCCAGG + Intronic
1116310949 14:43326527-43326549 GAGGGGCTCCCTCAGAGCAGTGG - Intergenic
1118633775 14:67729142-67729164 CAGGGACACACTCTGAGCCCAGG - Intronic
1121001494 14:90454667-90454689 CTCGGGCTCCCGCCTAGCCCAGG - Intergenic
1121690961 14:95876857-95876879 GAGGTCCTCCCGCCGAGCCCCGG + Intergenic
1122628211 14:103094930-103094952 AAGGGCCTCACTCAGAGCCCAGG + Intergenic
1122876173 14:104666383-104666405 CAGGGCCTCCCTCCTCCCCCAGG + Intergenic
1122972413 14:105157835-105157857 CAGGGGCAGCGTCTGAGCCCTGG - Intronic
1202872646 14_GL000225v1_random:177958-177980 CAGGGGCTCCCTCCGAGCCCGGG + Intergenic
1124142313 15:27088333-27088355 CTGGGGCTTCCCCAGAGCCCTGG - Intronic
1125626962 15:41116436-41116458 CAGGGTCTCCCCTCGAACCCCGG - Intergenic
1127934598 15:63624668-63624690 CAGGGTCTCACTCTGTGCCCAGG - Intronic
1128219616 15:65958946-65958968 CAGGTTCTCCCTGCCAGCCCAGG - Intronic
1129082128 15:73051536-73051558 CGGGGGCCCCGACCGAGCCCTGG - Intergenic
1129107355 15:73319179-73319201 CAGAGGGTTCCTCCGGGCCCTGG - Intergenic
1129462260 15:75705247-75705269 CAGCGGCTGCCTGCCAGCCCAGG - Intronic
1129722600 15:77886601-77886623 CAGCGGCTGCCTGCCAGCCCAGG + Intergenic
1132100315 15:99018420-99018442 CAGGGGGTCCCTCAGAGCTCAGG - Intergenic
1132312514 15:100867415-100867437 GAGGGGCTCCTTCCGAGCCCTGG - Intergenic
1132674897 16:1117475-1117497 GAGGGGCTCCCTCCCGGCCCTGG - Intergenic
1132851777 16:2028063-2028085 CAGGGACTCCCTCCAGACCCTGG + Intronic
1132905206 16:2278923-2278945 CAGGTGCACCTCCCGAGCCCTGG - Exonic
1133291989 16:4728449-4728471 CAGGGGCTGCCACTGAACCCTGG - Intronic
1134103662 16:11470376-11470398 CTGGGGCTCCCTGTGAGACCAGG + Intronic
1134191023 16:12121344-12121366 TAGGGGCTCCCCCAGAGCCTGGG + Intronic
1134430665 16:14202462-14202484 AAGGGTCTCCTTCTGAGCCCGGG - Intronic
1135045721 16:19153532-19153554 TAGGGGATCCCTCTGAGCACTGG - Intronic
1135472095 16:22740361-22740383 CAGGGTCTCACTCTGAACCCAGG + Intergenic
1135742592 16:24989154-24989176 CAGGGGCTCCCTCCACACCTGGG + Intronic
1137548577 16:49421170-49421192 CAGGGGCACCCCACGAGCACAGG - Intergenic
1137665995 16:50249512-50249534 CATGGGTTCCCCCTGAGCCCTGG + Intronic
1137722245 16:50634032-50634054 CAGAGGCTCCCTCGGGGCTCGGG + Exonic
1137753310 16:50882387-50882409 CAGGGGCACCCTGGAAGCCCCGG + Intergenic
1138599273 16:58045505-58045527 CAGGGGCTCCCTCCGCCCCCAGG + Exonic
1138604780 16:58081672-58081694 CAGGGGTTTCCTCCGGGCCGAGG - Intergenic
1139954274 16:70685871-70685893 CGGGCGCTCGCTCCGAGGCCGGG + Exonic
1140124038 16:72105694-72105716 CAGGGCCTCGCTCCTGGCCCTGG + Intronic
1142000229 16:87660132-87660154 CAGGACCTGCCTCCGAGCCTGGG + Intronic
1142139173 16:88465061-88465083 CAAGGGCTCCCACCCACCCCAGG - Intronic
1142549950 17:732424-732446 CCGGGGAACCCTCCGGGCCCAGG + Exonic
1142742761 17:1940649-1940671 TTGGGGCCCCCTCCCAGCCCTGG - Intronic
1143632848 17:8148695-8148717 CAGGGGCCCCATCTGAGACCCGG + Exonic
1143874202 17:9979507-9979529 CAGGAGCTGCCTCCGGTCCCTGG - Intronic
1144334146 17:14254448-14254470 AAGGGGCTCCTTCCAGGCCCTGG + Intergenic
1144829017 17:18121490-18121512 CAGGGGCGCCCGCCAGGCCCCGG - Exonic
1144875131 17:18393611-18393633 CCTGGGTTCCCTCCGAGCACAGG + Intergenic
1146143448 17:30388926-30388948 CAGAGCCTCCTCCCGAGCCCAGG + Intronic
1147261088 17:39210148-39210170 CAGAGGTGCCCTCCGAGACCGGG - Intergenic
1147943441 17:44066362-44066384 CTGGGGCTCTCTCCGGGCCTAGG - Intronic
1148872737 17:50668329-50668351 CAGGGGGTCCTGCCTAGCCCAGG + Intronic
1149867923 17:60161023-60161045 CAGGGGCTGCCGCAGTGCCCAGG + Intronic
1150285908 17:63954041-63954063 CAGGTTCTTCCTCGGAGCCCTGG + Intronic
1150631866 17:66885519-66885541 CAGCAGCTCCCCCCAAGCCCAGG + Intergenic
1151431080 17:74063673-74063695 CAGTGGCTCCCACTGAGCCAGGG + Intergenic
1151545485 17:74790407-74790429 CAGGGCCTGCCTCAGAACCCAGG - Intronic
1152304009 17:79510823-79510845 CAGGTGCTCGCCCCGAGTCCTGG - Intronic
1152516246 17:80826512-80826534 CAGGGCCTCCGGCCCAGCCCAGG + Intronic
1152780923 17:82227152-82227174 CAGGTGCTCCCTGGGACCCCTGG + Intergenic
1153152435 18:2110407-2110429 CAGGGTCTCCCTTCTTGCCCAGG - Intergenic
1154412688 18:14149911-14149933 CAGCAGCTCCTTCAGAGCCCCGG + Intergenic
1156260629 18:35442506-35442528 CAGGGGCTTCCACAGAGCCCAGG - Intergenic
1157004963 18:43571513-43571535 CAGGTGCTCTATCCGTGCCCAGG + Intergenic
1157529399 18:48409009-48409031 CAGGGGCGCCCTCCGCGCGGTGG - Intronic
1157810531 18:50692269-50692291 CAGGGCCTCTCTCCGCGCTCTGG + Intronic
1157828047 18:50830488-50830510 CAGAGTCTCGCTCCGCGCCCAGG - Intergenic
1159284899 18:66336573-66336595 CATGGGCTCCCTTCTGGCCCAGG + Intergenic
1160682207 19:417018-417040 CAGCCGCTGCCTCGGAGCCCTGG - Exonic
1160957239 19:1699375-1699397 CAGGGCCTCCCTCCCAGCGGGGG - Intergenic
1161059587 19:2208242-2208264 CAGGGGAAGCCTCCCAGCCCTGG - Intronic
1161078561 19:2299060-2299082 CCGGGGCACCCTCCAAGCTCTGG + Intronic
1161153527 19:2721272-2721294 CAGGGACCCCCTCCCCGCCCCGG + Intronic
1161169068 19:2804069-2804091 CGGGAGCTCACTCCGACCCCAGG - Intronic
1161324833 19:3658584-3658606 CAGGGGACCCCGCCAAGCCCTGG + Intronic
1161482207 19:4516861-4516883 TGGGGGCTCCCCCCAAGCCCAGG + Intronic
1161589602 19:5123368-5123390 AAGGTGCTGCCTCCAAGCCCAGG - Intronic
1161659391 19:5536703-5536725 CAGGAGCTCCCTCCCGGTCCCGG + Intergenic
1161988107 19:7668965-7668987 CAGGGGCTTCCTCTTGGCCCCGG + Intergenic
1162073270 19:8167708-8167730 CAGGGTCTCACTCTGTGCCCAGG - Intronic
1162408361 19:10489559-10489581 CAGGGGGTCTCTCCCAGGCCTGG + Intronic
1162833728 19:13302929-13302951 CAGGGTCTTCCTCTCAGCCCTGG - Intronic
1162910935 19:13847519-13847541 CAGGGTCCCCCTCCCTGCCCAGG + Intergenic
1162948020 19:14055147-14055169 CAGAGTCCCCCTCTGAGCCCAGG - Exonic
1163157423 19:15447131-15447153 CAAGGGCTTCCTCCGTGCCAAGG - Intronic
1163157913 19:15449355-15449377 CAGGTGCTTCCTCCGGGCCTGGG - Intronic
1163550188 19:17962207-17962229 CAGGGGCTCCCTGACAGCCTTGG + Intronic
1163568482 19:18066011-18066033 CAGGGACTCACTCTGTGCCCAGG - Intronic
1163705075 19:18807788-18807810 GAGAGGCTCCCTCCCAGACCTGG + Intergenic
1165406167 19:35632673-35632695 CAGGAGCTCCCTGAGAACCCTGG + Intronic
1165860246 19:38905567-38905589 CAGGTGCTCTCGCCTAGCCCAGG - Intronic
1165923586 19:39313886-39313908 CAGGGCCTCCTCCCAAGCCCAGG - Intronic
1166220771 19:41363218-41363240 CAGGGTCTCTCTCTGCGCCCGGG - Intronic
1166566941 19:43771134-43771156 CAGGTCCTCCCACCCAGCCCTGG - Intronic
1167296716 19:48654748-48654770 CAGGGGCCTCCTCAGAGCTCTGG + Intergenic
1167446947 19:49543338-49543360 CAGGGGGTCCCTGAGAGCCCAGG - Exonic
1168233987 19:55050446-55050468 CAGGGTCTCCCTCTGACACCTGG + Intronic
925131002 2:1493967-1493989 CAGGGGCCCTGTCCGAGCCCTGG - Exonic
925388881 2:3482421-3482443 CAGGGGCTACCTCTGGGCCTGGG - Intronic
925865907 2:8225561-8225583 CAGGGGCTTCCTCTTAGCCTTGG - Intergenic
926554447 2:14341307-14341329 CAGTGGCTACATCCGTGCCCAGG - Intergenic
927210293 2:20634983-20635005 CAGGGACCCCCTCCAGGCCCTGG - Intronic
930145240 2:47995649-47995671 CTGGGGCTGCCTCCGAGAACTGG + Intergenic
931117277 2:59178507-59178529 CAGGGTCTCCCTCATTGCCCAGG - Intergenic
933997268 2:87679199-87679221 CAGGGGCTCCCTCCCCACACTGG - Intergenic
934954907 2:98609058-98609080 CAGCTGCTCCCTCCCTGCCCGGG - Intronic
936155286 2:110042972-110042994 CAGGGGCCCCCTCCCAGCCCTGG + Intergenic
936189394 2:110328441-110328463 CAGGGGCCCCCTCCCAGCCCTGG - Intergenic
936260823 2:110958641-110958663 CATGGGATCCCTCAGTGCCCTGG - Intronic
936296584 2:111271711-111271733 CAGGGGCTCCCTCCCCACACTGG + Intergenic
938289705 2:130142718-130142740 CAGCGGCCCCCACCCAGCCCAGG - Intronic
938466821 2:131530220-131530242 CAGCGGCCCCCACCCAGCCCAGG + Intronic
938897391 2:135765764-135765786 CAGGGACTCCATCCTAGGCCAGG + Intronic
943763522 2:191635539-191635561 CAGGGACTCCCTCCATCCCCAGG - Intergenic
944631365 2:201628775-201628797 CAGACTCTCCCTCAGAGCCCTGG + Intronic
947637289 2:231686471-231686493 CAGGGGCTCACTGGGAGTCCAGG - Intergenic
947793310 2:232879735-232879757 CAGAGGCTCCCTCCTGGCCAGGG + Intronic
948341535 2:237256607-237256629 CACCGTCTCCCTCCCAGCCCAGG + Intergenic
1170857241 20:20068499-20068521 CAGGGGCCCCATACGAGCACTGG - Intronic
1171232768 20:23500659-23500681 CAGGGGCACCGTCCGCCCCCAGG - Intergenic
1172162123 20:32876040-32876062 CAGGGGCACCCTCCTCACCCAGG - Exonic
1173741681 20:45406504-45406526 CAGGGGCTGCCTCCGACCGCCGG + Intronic
1174290808 20:49507275-49507297 CAGGGGCACCCTCCAAACACTGG - Exonic
1174475066 20:50790714-50790736 CAGTGGCTCCATCCCAGCCTGGG - Intergenic
1175828815 20:61951079-61951101 CTGGGACTCCCTCCCAGCCCTGG + Intergenic
1176018889 20:62952768-62952790 CCGGGGCTGCCTCCCAGCCCAGG - Exonic
1176185776 20:63778060-63778082 CAGGGTTTCCCTCTGAGCCGAGG + Intronic
1176860318 21:14008344-14008366 CAGCAGCTCCTTCAGAGCCCCGG - Intergenic
1178883952 21:36470494-36470516 CAGATGCTCCCTCACAGCCCTGG + Intronic
1179511540 21:41877131-41877153 CAGAGGCTCCCTCACAGCACTGG + Intronic
1179613978 21:42569895-42569917 CAGGCGCCCCCGCCCAGCCCTGG + Intronic
1179882724 21:44300254-44300276 CCGGAGCGCCCGCCGAGCCCCGG + Intronic
1180166425 21:46033127-46033149 CAGCCGCCCCCTCCGAGGCCCGG - Intergenic
1180166440 21:46033162-46033184 CAGCCGCCCCCTCCGAGGCCCGG - Intergenic
1180166455 21:46033197-46033219 CAGCCGCCCCCTCCGAGGCCCGG - Intergenic
1180166470 21:46033232-46033254 CAGCCGCCCCCTCCGAGGCCCGG - Intergenic
1180201595 21:46228052-46228074 CAGGGTCTCCTGCCGAGCCCCGG - Intronic
1180285448 22:10741518-10741540 CCGGGGCTCCCTCGGAGCCCGGG - Intergenic
1180839803 22:18954080-18954102 CAGGGCCTCTCCCCGAGCTCTGG + Intergenic
1181054291 22:20252790-20252812 CAGAGGCTACATCTGAGCCCAGG - Intronic
1181062092 22:20286399-20286421 CAGGGCCTCTCCCCGAGCTCTGG - Intergenic
1181508800 22:23379664-23379686 CAGCTGCTCCCACCGGGCCCTGG + Intergenic
1183062630 22:35345478-35345500 AAGGAGCTCCCTCTGACCCCTGG + Intronic
1183478036 22:38046671-38046693 CTGAGGCTCCCTCGGAGGCCTGG + Intergenic
1183568769 22:38635963-38635985 CAGGGTCTCCCTCTGTACCCAGG - Intronic
1184038219 22:41928555-41928577 CAGGGTCTCCCTCTGCCCCCAGG - Intergenic
1184491936 22:44814878-44814900 CTGGGGCTCCCTACCCGCCCTGG + Intronic
1184756714 22:46520243-46520265 CAGGGCCTCCTTCTGAGCTCGGG - Intronic
1185109031 22:48890569-48890591 CAGGGGCTCCACACGAGGCCAGG + Intergenic
1185226546 22:49656812-49656834 AAGTGGCTGCCTCGGAGCCCAGG + Exonic
1185417813 22:50719899-50719921 CAGGGTCTTGCTCGGAGCCCGGG + Intergenic
949718938 3:6966093-6966115 TTGGGGCTCTCTCCCAGCCCAGG + Intronic
950759319 3:15206456-15206478 CAGGGCCTCCTTCCCTGCCCCGG + Exonic
953391514 3:42536384-42536406 CGGGGGCAGCCTCCGAGCCCAGG - Exonic
953468592 3:43146984-43147006 CTGGGGCTCCCACTGATCCCTGG - Intergenic
958513050 3:95073622-95073644 CAGGGTCTCACTCCGTCCCCAGG - Intergenic
961010486 3:123432554-123432576 CAGGGTCTTGCTCCGTGCCCAGG + Intronic
961178198 3:124853482-124853504 CAGTGTCTGCCTCCAAGCCCAGG + Intronic
961466916 3:127087690-127087712 CAGAGGCTCGCTCCAGGCCCAGG - Intergenic
961655250 3:128438325-128438347 CAGGTGCCCCCTCAGTGCCCAGG + Intergenic
963269899 3:143276112-143276134 CATGGGCTCCCTCCTAGGACAGG - Intronic
964444338 3:156742954-156742976 CAGGGACTCACTCTGTGCCCAGG + Intergenic
964509737 3:157437696-157437718 CGGGGGCTCCCGCAGAGGCCAGG + Exonic
965605864 3:170496918-170496940 CTGTGGCTCCCCCAGAGCCCGGG + Intronic
967054944 3:185823757-185823779 AAGGGGCTCCCGCCGGGCCGGGG + Intronic
967976914 3:195040666-195040688 CAGGGGCTCCCTCAGGAACCTGG + Intergenic
968284253 3:197498965-197498987 CAGCGGCTCCCTGGGAGCCCCGG - Intergenic
969282838 4:6182752-6182774 CAGGGGCTCCCCGCTGGCCCAGG - Intronic
969532117 4:7735890-7735912 CAGGGGCGGCCTTCGAGCCCAGG + Intronic
969621711 4:8281981-8282003 CAGCTGGTCCCTCCGAGCCCTGG - Intronic
969831105 4:9797814-9797836 CAGGGTCTCACTCTGCGCCCAGG + Intronic
973338588 4:48981493-48981515 CAGTGGCTCCCTCCGCCTCCTGG - Intergenic
973972112 4:56223782-56223804 CAGGGTCTCACTCTGTGCCCAGG + Intronic
978454472 4:108872916-108872938 CAGGGTCTCACTCTGTGCCCAGG + Intronic
978506349 4:109462188-109462210 CAGGGTCTCGCTCTGACCCCAGG - Intronic
978532319 4:109727773-109727795 CAAGGTCTCCCTCTGTGCCCAGG - Intronic
981324066 4:143426515-143426537 CAAGGTCTCCCTCTGTGCCCAGG - Intronic
983929297 4:173435431-173435453 CAGGGCACCCCTCGGAGCCCCGG - Intergenic
985671580 5:1209514-1209536 CAAGGCCTCCCTCCAGGCCCAGG + Intronic
986132251 5:4942412-4942434 AAGGGGCGCCCTCCTGGCCCAGG - Intergenic
986334151 5:6740756-6740778 CAGAGGTTCCCTCCAGGCCCAGG + Intronic
986402724 5:7395878-7395900 GAGGGGCTCCCGCTGCGCCCCGG - Intergenic
986679359 5:10219630-10219652 CAGGGGCTCACTCCATCCCCTGG - Intergenic
988381530 5:30502763-30502785 CAGGGTCTCACTCTGTGCCCAGG - Intergenic
990465963 5:56071702-56071724 CAGGCGCTGCCTTCCAGCCCTGG - Intergenic
990581821 5:57173569-57173591 CCGGGGCTGCCTCGGAGTCCGGG - Intergenic
995028584 5:107452703-107452725 CAGGGTCTCATTCTGAGCCCAGG - Intronic
996398569 5:123036315-123036337 CAGGGTCTCCCCCGGAGCGCCGG + Intronic
998078658 5:139256809-139256831 CAGGGTCTCCCTCGTTGCCCAGG - Intronic
998152604 5:139765724-139765746 CAAGGGCTGAATCCGAGCCCAGG + Intergenic
999255632 5:150208705-150208727 CAGGGGCTCCCTCTTCTCCCTGG + Intronic
1001205988 5:169763580-169763602 CAGAGGCCTCCTCCCAGCCCTGG - Intronic
1001934362 5:175694071-175694093 CAGGGCCTCCCTCCCAGGGCTGG + Intergenic
1002372999 5:178769604-178769626 CAGGGGCTCTGTCACAGCCCTGG - Intergenic
1002480331 5:179496842-179496864 CTGGGGCTCAGTCCGACCCCAGG + Intergenic
1002563854 5:180099409-180099431 CAGGTGCAGCCTCGGAGCCCAGG - Intergenic
1002634629 5:180600975-180600997 CAGGGTGTCCCCCCGTGCCCAGG - Intergenic
1003307314 6:4941272-4941294 CAGGGGCTGCCTTCAAGCCTGGG - Intronic
1003563617 6:7204000-7204022 CAGGAGCATCCTGCGAGCCCTGG + Intronic
1004155620 6:13165443-13165465 CAGGTGCTCCCTCCGTGCCAAGG + Intronic
1004170881 6:13294752-13294774 CATGGACTGCCTCCAAGCCCCGG + Intronic
1004687262 6:17958904-17958926 CAGGGTCTCACTCTGTGCCCAGG + Intronic
1006055215 6:31378927-31378949 CAAGGGCTCCTTCCCAGCTCAGG - Intergenic
1006547587 6:34792404-34792426 CAGGGGCTGCCACGGAGTCCGGG - Intronic
1007498277 6:42276860-42276882 CAGTTGCTCCCTCCAAGCCCTGG + Intronic
1007617177 6:43187016-43187038 CAGTGGCTTCCTCAGGGCCCAGG - Exonic
1007769064 6:44178895-44178917 CAGGGTCTCACTCTGCGCCCAGG - Intronic
1008536814 6:52512494-52512516 CTGGGGCACCCTCTGAGCTCAGG + Intronic
1010001875 6:70956656-70956678 CAGGGGCTGCCCCCGACTCCAGG + Exonic
1010240841 6:73614239-73614261 CAGGGGCTCACTCTTAGCCCAGG - Intronic
1011474762 6:87740711-87740733 CAGGGTCTCACTCTGCGCCCAGG + Intergenic
1012462666 6:99481066-99481088 CAGGGTCTCGCTCTGTGCCCAGG - Intronic
1012905153 6:105055791-105055813 CAGGGTCTTCCTTCCAGCCCAGG + Intronic
1012910140 6:105108984-105109006 CAGGGTCTCACTCTGTGCCCAGG + Intronic
1015626181 6:135182389-135182411 CCGGGGCTCCCTGCGAGCGGCGG + Intronic
1015917038 6:138227988-138228010 CATAGCCTCCCTCCAAGCCCAGG + Intronic
1016714211 6:147204503-147204525 GAGGGGCTCCCCCGCAGCCCGGG - Intronic
1018195754 6:161355137-161355159 CAGGGGCTGCCTCCGCACACCGG + Intronic
1019275546 7:173658-173680 CAGAGCCTCCCTCAGAGCCCCGG - Intergenic
1019313698 7:375012-375034 CAGAGGCTGCCTCTGAGCCCGGG - Intergenic
1019424593 7:968348-968370 CAGTGGCTGTCTCCAAGCCCTGG - Exonic
1019429634 7:992703-992725 CTGGGGCTCCCTCAGAGCGGGGG + Intergenic
1019607510 7:1917493-1917515 CAGGCGCTTCCCCTGAGCCCCGG - Intronic
1019903817 7:4045266-4045288 CAGGGTCTCACTCTGTGCCCAGG + Intronic
1020204766 7:6105503-6105525 CCGGAGCCCCCTCAGAGCCCCGG + Intronic
1022218365 7:28287780-28287802 GTGTGGCTCCCTCTGAGCCCAGG + Intergenic
1023866126 7:44239263-44239285 CAGTGGCTCCCTGTGGGCCCAGG + Intronic
1023871676 7:44266680-44266702 CAGCGGCTCCCTACCTGCCCAGG + Intronic
1023937122 7:44748427-44748449 CCGGGGCCCGCCCCGAGCCCTGG + Intergenic
1024639142 7:51316124-51316146 CTGGGGCTGCCGCCGAGGCCGGG + Intronic
1026685434 7:72505440-72505462 CTGGGGCTCCCTCCCTTCCCAGG + Intergenic
1026739292 7:72968843-72968865 CAGAGGCTCGCTCTGAGCCCAGG - Intronic
1026790319 7:73327458-73327480 CAGAGGCTCGTTCTGAGCCCAGG - Intronic
1027104439 7:75396230-75396252 CAGAGGCTCGCTCTGAGCCCAGG + Intronic
1027440247 7:78211497-78211519 CAGGGTCTCCCTCACAGCCCAGG - Intronic
1029278173 7:99419912-99419934 CTGGGGCTCCCACAGAGCACTGG + Exonic
1032503409 7:132417204-132417226 CAGAGGCTCCCCCACAGCCCTGG - Intronic
1034412845 7:150950303-150950325 CAAGGGCTGCCTTCGGGCCCTGG - Exonic
1034489932 7:151387670-151387692 GCGGGGCTCCCTTGGAGCCCGGG - Intronic
1034497636 7:151431945-151431967 CAGGGGGTCCCTGGGAGTCCGGG + Intronic
1034530754 7:151695000-151695022 CCCGGGCTCCCTCCCTGCCCGGG - Intronic
1034873619 7:154705668-154705690 CAGGGGCTGTCTGGGAGCCCTGG - Intronic
1035065772 7:156104227-156104249 CAGAGGATCCCTCAAAGCCCTGG - Intergenic
1035345531 7:158194697-158194719 CACTGGCTGCCTCAGAGCCCTGG + Intronic
1035637552 8:1157796-1157818 CATCGCCTCCCTCCGATCCCAGG - Intergenic
1036045509 8:5135601-5135623 CAGGGTCTCACTCTGTGCCCAGG + Intergenic
1038176306 8:25184611-25184633 CCGGGGCCGCCTCCGAGCCGCGG - Intergenic
1039557164 8:38484787-38484809 CTGGGGGCCCCTCCCAGCCCAGG - Intergenic
1041223115 8:55671322-55671344 CAGGAGCTCCCTGCAAGCCATGG + Intergenic
1045370336 8:101516437-101516459 CAGGGTCTCCCTCTGTGGCCAGG + Intronic
1045759083 8:105582617-105582639 CAGGGTCTCACTCTGTGCCCAGG + Intronic
1048261250 8:132947025-132947047 AAGGGGCACACTCAGAGCCCAGG - Intronic
1048262199 8:132954658-132954680 CGGCAGCTCCCTCAGAGCCCTGG + Intronic
1048317771 8:133374939-133374961 CAGGGGCTTCCTGGGTGCCCAGG - Intergenic
1049216137 8:141409272-141409294 CCGGGGCTGTCTCTGAGCCCTGG + Intronic
1049414573 8:142489288-142489310 CGGGGGAGCCCTCCCAGCCCAGG - Intronic
1049510001 8:143022552-143022574 GAGGGGCTCCCTCTGAGGTCAGG - Intronic
1052762387 9:32605922-32605944 CAGGGCCTCCATTCCAGCCCTGG - Intergenic
1057225132 9:93289157-93289179 CAGGGGCTCCCTTGGGGCACTGG - Exonic
1057793878 9:98142372-98142394 CTGGTGCTCCCTCAGAGCACAGG - Intronic
1058022271 9:100102117-100102139 CAGGGTCTCCCTCTGTGCCCAGG + Intronic
1060162719 9:121380710-121380732 CAGGGTCTCACTCTGTGCCCAGG - Intergenic
1060465271 9:123898517-123898539 CAGGGTCTCCCTATTAGCCCAGG + Intronic
1060822815 9:126671389-126671411 CAGGGGCCCCAGCTGAGCCCGGG - Intronic
1061508946 9:131048917-131048939 CTGGGGCTCCCTCCTACCCCAGG + Intronic
1061992580 9:134167591-134167613 CATGGGTTCCCTTCCAGCCCTGG + Intergenic
1062084406 9:134641505-134641527 CTGGGGCGGCCTCGGAGCCCAGG - Intergenic
1062325071 9:136009045-136009067 CAGCGGCTCCCTCCCTGTCCTGG + Exonic
1062334886 9:136060745-136060767 CAGGGGGACCCTCAGAGCCCTGG + Intronic
1062392048 9:136337761-136337783 CAGGGGCTGCCTCCCTGCCCAGG - Intronic
1062413024 9:136434274-136434296 CAGAGGCTGCCTCGGAGACCGGG - Intronic
1062413314 9:136435370-136435392 CAGGGTCTCACTCCGTGCCCAGG + Intronic
1062488372 9:136792127-136792149 GTGGGGCTCCCGCCGAGACCTGG - Intronic
1203731811 Un_GL000216v2:98584-98606 CAGGGGCTCCCTCCGAGCCCGGG - Intergenic
1186406138 X:9304986-9305008 CAGGGTCTCACTCTGTGCCCAGG + Intergenic
1186407687 X:9318055-9318077 CCGGGGCTTCCTCCAAGCTCTGG + Intergenic
1187341686 X:18426132-18426154 CTCGGGCTCCCTCCGAACTCGGG - Intronic
1187410994 X:19050366-19050388 CTGGGGTTTCCCCCGAGCCCTGG - Intronic
1187859566 X:23667904-23667926 CCTGGGCTGCCTCCGGGCCCTGG + Intronic
1190900985 X:54672849-54672871 AAGGGGCTCAGTCCAAGCCCAGG + Intergenic
1192210181 X:69123012-69123034 CAGGGGCTGCCACCCAGCACTGG - Intergenic
1192772592 X:74208210-74208232 CAGGGTCTCCCTCTGCACCCAGG + Intergenic
1200240562 X:154490895-154490917 CTGGGGCTCCCTCCCAGAGCGGG - Intergenic
1200953953 Y:8927197-8927219 GAGGGGATCCTTCCCAGCCCAGG - Intergenic
1202199402 Y:22331041-22331063 GAGGGGATCCTTCCCAGCCCAGG - Intronic
1202232058 Y:22668577-22668599 GAGGGGATCCTTCCCAGCCCAGG - Intergenic
1202311098 Y:23527581-23527603 GAGGGGATCCTTCCCAGCCCAGG + Intergenic
1202559704 Y:26143013-26143035 GAGGGGATCCTTCCCAGCCCAGG - Intergenic