ID: 1202872647

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177963-177985
Sequence GCTCCCTCCGAGCCCGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 2, 1: 1, 2: 1, 3: 11, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872643_1202872647 -10 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG 0: 2
1: 1
2: 1
3: 11
4: 168
1202872639_1202872647 2 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG 0: 2
1: 1
2: 1
3: 11
4: 168
1202872634_1202872647 27 Left 1202872634 14_GL000225v1_random:177913-177935 CCACGCCTCAGCGAGAGGACGGA No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG 0: 2
1: 1
2: 1
3: 11
4: 168
1202872638_1202872647 3 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG 0: 2
1: 1
2: 1
3: 11
4: 168
1202872635_1202872647 22 Left 1202872635 14_GL000225v1_random:177918-177940 CCTCAGCGAGAGGACGGAGCCCT No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG 0: 2
1: 1
2: 1
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872647 Original CRISPR GCTCCCTCCGAGCCCGGGCA TGG Intergenic
900610218 1:3541572-3541594 TCTCCCGCGGAGCCCAGGCACGG - Intronic
900623460 1:3597732-3597754 GCCCCCTCAGAGCCCCTGCAGGG + Intronic
901168586 1:7237306-7237328 GCTGCCTCCGGGCCAGGGCTGGG + Intronic
902822801 1:18953836-18953858 TCTCCCTCCAAGACTGGGCACGG + Intronic
906263074 1:44407602-44407624 GCTCGCTCCGCGCCCGGCCCCGG - Intronic
906720039 1:47997536-47997558 GCTAGCTCCGCGCCCGGGCGCGG + Intergenic
907440366 1:54474927-54474949 GCTCCCCCTGCGCCCGGGCGGGG - Intergenic
912569020 1:110608024-110608046 CCTCCCCCAGGGCCCGGGCAGGG + Intronic
920125784 1:203692844-203692866 GTTCCCACCCAGCCTGGGCAGGG + Intronic
920924481 1:210328877-210328899 GCGCCCTCCGCGCCCGGACTCGG - Intronic
922712233 1:227842865-227842887 GTTCCCTCAGAGGCCGGGCATGG - Intronic
1066460399 10:35608041-35608063 GCGCCCTCCGTGCACGGGCGTGG + Exonic
1067058546 10:43066062-43066084 CCTCACTCCGAGTCGGGGCACGG - Intergenic
1067347471 10:45446950-45446972 GCCCGCTCTGAGCCTGGGCATGG + Intergenic
1067806184 10:49395179-49395201 GCTCCCTCCCCGCCTGGGCCAGG - Intronic
1073460296 10:103661965-103661987 GCTGCCACCGAGCCCAGGCCGGG + Intronic
1074360805 10:112822974-112822996 ACTCACTCCAATCCCGGGCAAGG + Intergenic
1075885404 10:125895954-125895976 GCTCCCTCCGAGCCCGGGCATGG - Intronic
1076462478 10:130656267-130656289 GCTCCCTCCCCGCCTGGCCATGG + Intergenic
1077182800 11:1224043-1224065 GCTCCCCCCGGGCCCAGGCTGGG - Intronic
1077253278 11:1570109-1570131 GCTCCCTCCGATCCCAGGAACGG + Intronic
1077373627 11:2195163-2195185 GCCCCCTCCCTGCCCGGGGAGGG + Intergenic
1078559127 11:12355335-12355357 GTTCCCTCCCAGCGTGGGCAGGG + Intronic
1083161304 11:60855863-60855885 GCTCCCTCTGTGCCCAGGTAAGG - Exonic
1084151761 11:67290829-67290851 GCTCCCTCCGAGCCTGCTCCTGG - Intronic
1085771758 11:79331747-79331769 GCTTCCTGCAACCCCGGGCAGGG + Intronic
1091274685 11:134342351-134342373 GGTACCTCCGAGCCCCGGCACGG - Intronic
1097147546 12:56952037-56952059 GGTCTCTCCAAGCCCGGCCAAGG - Exonic
1102229496 12:111252713-111252735 TCTCCCTCAGAGCCCAGGCGGGG - Intronic
1102243777 12:111342112-111342134 GCTCCCTCCAGGCCCTGGGATGG - Intronic
1103972111 12:124678847-124678869 GCCCACTCCGTGCCCGGGAAAGG - Intergenic
1104653746 12:130557495-130557517 TCTGCTTCTGAGCCCGGGCAGGG - Intronic
1108408172 13:50124900-50124922 GCTCCCTCCGAGCTCGGACCCGG - Intronic
1112173114 13:96994216-96994238 TCTCCCTCCGGGTCAGGGCAGGG + Intronic
1113352942 13:109547384-109547406 GCACCCTCAGAGCTGGGGCATGG - Intergenic
1115993213 14:39170553-39170575 GCTCCCGCCTGGCCCGGGCGCGG + Intergenic
1117913797 14:60657105-60657127 GCTCCCGCACAGCCCGGGGAGGG - Intronic
1118817163 14:69321762-69321784 GCTCCTTCCCAACCCGGGCTAGG + Intronic
1119652641 14:76394515-76394537 GCTCCCTCCCAGCCCCCACAAGG - Intronic
1119872638 14:78030133-78030155 GCTCCCGCCGAGCCCAGGACAGG - Intergenic
1121690963 14:95876862-95876884 CCTCCCGCCGAGCCCCGGCGCGG + Intergenic
1122742559 14:103880680-103880702 CCACCCTCCTAGCCCGGGCCAGG + Intergenic
1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG + Intergenic
1126686219 15:51251077-51251099 GCTCCCCCTCAGCCCGGGCGTGG - Intronic
1128551244 15:68599322-68599344 GCTCCCTCCCACTCAGGGCATGG - Intronic
1132130684 15:99275658-99275680 GCTCCCTCAGAGCCCTGAGAAGG - Intronic
1132299163 15:100765908-100765930 GCAGCCTCTGAGGCCGGGCAGGG + Intergenic
1132745939 16:1436315-1436337 GTTCCCCCTGAGCCCGGGCCTGG - Intronic
1133012973 16:2925175-2925197 CCTCCCTCCCAGCCAGGGCGAGG - Intronic
1133275593 16:4636438-4636460 GCTCCCCCGGAGCCCGTCCACGG - Intronic
1134061509 16:11202247-11202269 GCTCCCTCTGAGGCCAGGAAGGG - Intergenic
1134644968 16:15858361-15858383 GCTCCCGCCGCTCCCGGGGAGGG - Intergenic
1138081258 16:54093438-54093460 GCTCCCTGGCAGGCCGGGCACGG + Intronic
1138599275 16:58045510-58045532 GCTCCCTCCGCCCCCAGGTAGGG + Exonic
1139954276 16:70685876-70685898 GCTCGCTCCGAGGCCGGGCCGGG + Exonic
1140096979 16:71883868-71883890 CCTCCCTCCGGGTCCGGGCTGGG - Intronic
1141683423 16:85556802-85556824 GCTCGCGCCGAGACCGCGCAAGG - Intergenic
1142113885 16:88346412-88346434 CCTCCCTCCCAGCCCTGGCCTGG + Intergenic
1142338755 16:89507607-89507629 CCGCCCTCCGGGCCCGGGCAGGG - Intronic
1144703299 17:17352167-17352189 GCTCGCTCAGAGCATGGGCATGG - Intergenic
1146057093 17:29586959-29586981 CCTCCCTCTGCTCCCGGGCATGG - Intronic
1147884639 17:43676402-43676424 GCTCCCTCCCATCCCGGGTTTGG + Intergenic
1148139203 17:45316684-45316706 GCTGGCTCCGAGCGCGCGCAGGG - Intronic
1151743820 17:76001116-76001138 CTGCCCTCCGAGGCCGGGCATGG + Intronic
1151957119 17:77385969-77385991 GATCCCTTCCAGCCCGGACATGG - Intronic
1153935317 18:9914887-9914909 GCTCTCCCCGGGCCGGGGCAGGG - Intronic
1157359168 18:46962913-46962935 GCTCCCTCCGGCCTCGGGGACGG - Exonic
1157360162 18:46968840-46968862 GCTCCCTCCGGCCTCGGGGACGG - Exonic
1157360763 18:47022432-47022454 GCTCCCTCCGGCCTCGGGGACGG - Exonic
1157361752 18:47028347-47028369 GCTCCCTCCGGCCTCGGGGACGG - Exonic
1160236140 18:77087992-77088014 CCACCCTCCGAGCCCAGGCAAGG + Intronic
1160511417 18:79455557-79455579 TCTCCCTGCGAACCAGGGCAGGG - Intronic
1160675822 19:390795-390817 TTTCCCTCTGAGCCCTGGCAAGG + Intergenic
1160861662 19:1239829-1239851 GCACCCCCCGAGCCAGGGCCAGG + Intergenic
1161589601 19:5123363-5123385 GCTGCCTCCAAGCCCAGGAAAGG - Intronic
1161649502 19:5475691-5475713 GCACACTCCTAGGCCGGGCATGG + Intergenic
1162349600 19:10140656-10140678 TCTCCTTCCGAGGCCAGGCACGG - Intronic
1162637900 19:11984795-11984817 GCGCCCACAGAGCTCGGGCATGG - Intergenic
1162769026 19:12938083-12938105 GCTCTCTCCCATCCCAGGCAGGG + Intergenic
1163157911 19:15449350-15449372 GCTTCCTCCGGGCCTGGGTAGGG - Intronic
1163427252 19:17246182-17246204 GCTCCCGCCGCGGCCCGGCAGGG - Intronic
925785180 2:7424957-7424979 GCTACCTTCGAGGCCAGGCATGG + Intergenic
927932206 2:27052237-27052259 GCTCCCTTCCAGCCAGGGCATGG - Intronic
928218100 2:29379175-29379197 GTTCCCTGGGAGCCCAGGCATGG + Intronic
932381876 2:71291620-71291642 GCTGCATCCGAGCCAGGGCGAGG - Intronic
935492841 2:103741480-103741502 GCTCCCTCCAAGCATGGGCCTGG + Intergenic
936041748 2:109155072-109155094 CCTCCCTCCGGGCCAGGGCAAGG + Intronic
938079916 2:128364496-128364518 GCTCCTTCCAGGCCCGGCCAGGG + Intergenic
943717699 2:191170335-191170357 GCTCCCTATGAGACCAGGCAGGG - Intergenic
945241604 2:207681626-207681648 GCTGCCCCGGACCCCGGGCAGGG + Intergenic
946665955 2:222050202-222050224 GCTGACTCAGAGCCTGGGCAGGG - Intergenic
948333870 2:237192984-237193006 GCTCCTTCCTTGCCCTGGCAGGG - Intergenic
948826681 2:240576486-240576508 GCCCCTTCCTAGCCTGGGCAGGG + Intronic
948935765 2:241163424-241163446 CTTCCCTGCGAGCCCTGGCAGGG + Intronic
1172146595 20:32762271-32762293 GTTCCCCCCGCGCCCGGGCGGGG + Intergenic
1173539150 20:43838389-43838411 ACTCCCTCTGGGCCAGGGCAGGG + Intergenic
1173655665 20:44698719-44698741 GCTGCCTCCCAGCCTGGACATGG - Intergenic
1175237455 20:57524830-57524852 ACTCCCTCGGAGGCCTGGCAGGG + Intronic
1178872186 21:36385749-36385771 GCGCCCTGAGAGCCCGGGGAGGG - Intronic
1179474591 21:41635110-41635132 GCTCTCTGAGAGCTCGGGCAGGG + Intergenic
1179783855 21:43719019-43719041 GCTTCCTCCCAGCCCGGGGGCGG + Intergenic
1179799308 21:43803525-43803547 GGAGCCCCCGAGCCCGGGCATGG + Exonic
1180285447 22:10741513-10741535 GCTCCCTCGGAGCCCGGGCATGG - Intergenic
1181000796 22:19987023-19987045 TCTGCCTCCGACCCCGGGCCAGG + Intronic
1181121699 22:20671275-20671297 GGTCCCTCCGCGCCCCGGCCCGG + Intergenic
1181168803 22:20997015-20997037 GCACCCTCCCTGCCTGGGCATGG - Intronic
1181588014 22:23864678-23864700 GGTCCATCCCAGGCCGGGCAGGG + Intronic
1181629104 22:24141195-24141217 GCTCCATTCAAGCCAGGGCAGGG - Intronic
1181799019 22:25332076-25332098 CCTCCCACCGTGCCCGGCCATGG - Intergenic
1181964753 22:26648441-26648463 GCTCCCTGCGACCTCAGGCAAGG + Intergenic
1182676276 22:32042293-32042315 CCTCCCTCTGAACCCTGGCATGG + Intergenic
1183364273 22:37399029-37399051 GCTCCCTCCGGGCCAGGAAAAGG - Intronic
1184276396 22:43411746-43411768 GCGGACTCCGAGCCCGGGCGGGG + Intronic
1184658542 22:45954600-45954622 GCCCCCTGCGTGCCCGTGCATGG + Intronic
1184745442 22:46453078-46453100 CCTCCCTCCGAGGCATGGCAGGG - Intronic
1185190450 22:49433053-49433075 GCTGCCTCAGCTCCCGGGCAGGG - Intronic
1185289015 22:50014804-50014826 GCTCCCTCCGCGCCCGCGCTGGG + Intergenic
1185395143 22:50582942-50582964 GCTCTCTCCGTGCCCCGGCCCGG + Exonic
950422100 3:12905288-12905310 GCTTCCTCAGAGTCAGGGCAGGG + Intronic
961535095 3:127565762-127565784 GATCCATCCGAGCCTGAGCAGGG - Intergenic
962809099 3:138946614-138946636 GCCGCCGCCGAGCCCAGGCAAGG - Exonic
963971042 3:151429765-151429787 CCACCCTCAGAGCCCGGGCCTGG - Intronic
968645865 4:1740199-1740221 GCTCCCACGGAGCCAGGGCTTGG + Intronic
972418904 4:38868263-38868285 GCTCCCTTCGTGCCCGGGCTGGG - Intronic
973712402 4:53642836-53642858 GATCCCTCCCAGCCATGGCATGG + Intronic
985644235 5:1077603-1077625 GGTCCCTCCGAGCTCGGCCCCGG - Intronic
986718109 5:10538532-10538554 GCAGCCTCCGAGCCTGGGCTTGG + Intergenic
987165617 5:15194828-15194850 TATCCCTCCGAGTCCAGGCAAGG - Intergenic
990148283 5:52787829-52787851 GCGCCCTCCCTGCCCGGGCCGGG + Intergenic
997253625 5:132410676-132410698 CCTCCCGCCCAGCCCGGGCCCGG + Intronic
1004126432 6:12878513-12878535 GCTCCCTGAGAGCAAGGGCAAGG - Intronic
1004933187 6:20481443-20481465 ACCCCCTCAGAGCCGGGGCATGG - Intronic
1006735969 6:36272753-36272775 GCCCCCTCCCAGCCCAAGCAGGG + Intronic
1006780298 6:36627856-36627878 CCTCCCTCCGGGCCAAGGCAGGG + Intergenic
1007727269 6:43924025-43924047 GCCCCCTCCCCGCCTGGGCAAGG - Intergenic
1013228043 6:108134798-108134820 GATCCCTCCGAGTCAGGGCCGGG + Intronic
1018794639 6:167176383-167176405 GCACCCTCGGAACGCGGGCACGG + Intronic
1018821681 6:167378684-167378706 GCACCCTCGGAACGCGGGCACGG - Intronic
1019297989 7:289363-289385 CCTCCCTCCGGGCCCTGGCGGGG + Intergenic
1019524738 7:1475883-1475905 CCTCCCTCCCTGCCCGGCCAGGG + Intronic
1019622951 7:2001494-2001516 GCTGCCTCCGAGCCTGGGTGGGG - Intronic
1020889080 7:13856265-13856287 GCTCCCTCAAAGCCAGGGCCAGG - Intergenic
1022989597 7:35694830-35694852 CCGCCCTCCGCGCCCAGGCAGGG + Exonic
1023791867 7:43758899-43758921 CCTCACTCCGGGCCCGGGCGGGG - Intronic
1026157027 7:67835159-67835181 GTTCCCTCAGAGGCCGGGCGCGG - Intergenic
1027592654 7:80135112-80135134 GCTCCCTCCGCGCCCGAGTGCGG - Exonic
1027910696 7:84246046-84246068 GATTCCTCCCACCCCGGGCAGGG - Intronic
1029304164 7:99606669-99606691 AGTCCCTCAGAGCCTGGGCAGGG - Intronic
1029732528 7:102447571-102447593 GCTCCCTCCAGGGCCAGGCAGGG - Exonic
1033647450 7:143316186-143316208 CCTCCCCCCGAGCCCCGGCCAGG - Exonic
1033810007 7:145001624-145001646 GCTCCTTCGGACCCTGGGCAGGG + Intergenic
1034417833 7:150974581-150974603 GAACGCCCCGAGCCCGGGCAGGG - Intronic
1036211064 8:6841715-6841737 GCTCCCTCTGTGCCAGGGCCTGG - Intergenic
1037901425 8:22691553-22691575 GCACCCTCCGCACCTGGGCAAGG - Intronic
1038581634 8:28753321-28753343 GCACCCTGCGAGCCAGGACAAGG - Exonic
1043484691 8:80687489-80687511 GACCCCTGCGTGCCCGGGCATGG + Intronic
1048606006 8:135969625-135969647 CCTCCCTCGGAGCCCTTGCATGG - Intergenic
1048882608 8:138883152-138883174 GTTCCCTCGGAGGCCGGCCATGG + Exonic
1049217196 8:141413619-141413641 GCTCCCTCCTGCCCAGGGCAAGG + Intronic
1049344386 8:142130589-142130611 GCTCCCTCTTAGCCCTGGGATGG - Intergenic
1049621262 8:143599350-143599372 GCTGCCTTCGAGCCCCGGCCCGG + Exonic
1049686119 8:143939965-143939987 GCTCCCTCCAGGCCTGGGCCAGG + Intronic
1053312368 9:37027723-37027745 GCTCCCTCCGGGCGGGGGCGGGG + Intronic
1055057806 9:72039691-72039713 TCTCCCTGTGAGCCTGGGCAGGG + Intergenic
1055757751 9:79573156-79573178 GCGCCCTCCCCGCCCGGGCGCGG - Intronic
1057801379 9:98193066-98193088 GCGCGCGCCGAGCCCGGCCAGGG + Intergenic
1058790174 9:108436457-108436479 TATCTCTCCGGGCCCGGGCAGGG - Intergenic
1059375401 9:113876646-113876668 GCCCCCTCCGGCCCCGGGCTCGG + Intronic
1060422994 9:123482887-123482909 GCTCCAACCAAGCCTGGGCATGG + Intronic
1060974601 9:127757209-127757231 GCCCCCTCCTAGGCTGGGCACGG - Intronic
1060989139 9:127838365-127838387 GCTTCCCCCAAGCCCAGGCAGGG + Intronic
1061076685 9:128345609-128345631 GCTCCCTTCCAGCCCTGCCAAGG + Intronic
1061261776 9:129484112-129484134 GCTCCCTCAGATCCCAGGTAGGG - Intergenic
1062501366 9:136853381-136853403 GCTGGCTCCGAGACAGGGCAGGG + Exonic
1062538937 9:137032981-137033003 GCTCCCTCTAAGCCAGGGCCTGG + Exonic
1187045808 X:15646838-15646860 GCTCCCTCTGCGCTCGGGCGGGG - Intronic
1187341684 X:18426127-18426149 GCTCCCTCCGAACTCGGGCAGGG - Intronic
1192965610 X:76173536-76173558 GCTCCCCCCAAGGCCGGGCGCGG - Intronic
1197326905 X:125105647-125105669 TCTCCCTCAGATCCCAGGCAGGG + Intergenic
1197414988 X:126164725-126164747 CCTCCCTGCGGGCCCCGGCATGG + Exonic
1200111548 X:153743362-153743384 ACTCCCACCGACCCCAGGCAGGG - Intronic
1200203026 X:154295571-154295593 GCTCCCTCCGCGCGGGTGCAGGG - Intronic
1200400687 X:156018785-156018807 GGACCCTCCGAGCCCAGGCGTGG - Intergenic