ID: 1202872647

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177963-177985
Sequence GCTCCCTCCGAGCCCGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872638_1202872647 3 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG No data
1202872643_1202872647 -10 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG No data
1202872639_1202872647 2 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG No data
1202872634_1202872647 27 Left 1202872634 14_GL000225v1_random:177913-177935 CCACGCCTCAGCGAGAGGACGGA No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG No data
1202872635_1202872647 22 Left 1202872635 14_GL000225v1_random:177918-177940 CCTCAGCGAGAGGACGGAGCCCT No data
Right 1202872647 14_GL000225v1_random:177963-177985 GCTCCCTCCGAGCCCGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872647 Original CRISPR GCTCCCTCCGAGCCCGGGCA TGG Intergenic